2.1 Collection of Pluteus pantherinus Uchida and fungi isolation
In this study, a batch of mushroom samples were collected from the tropical rainforest of Qixianling, Baoting Li and Miao Autonomous County, Hainan Province, China (109°42'10.628" E,18°42'28.713" N). Afterwards, the surface of mushrooms was washed, dried, and ground. Next, 5 g mushroom powder was added to 45ml of sterile water, and suspension was shaken at 28℃,180 rpm for 30 min. The suspension was then diluted from 10− 2 to 10 − 3 fold, and spread on the Bengal red culture-medium 28℃ for 3–5 days [22]. Individual colonies with mycelial attachment on the media were picked on PDA for purification and strains were stored at 4°C by glycerol preservation.
2.2 Detection of siderophores production in the strains
2.2.1 Screening siderophore-producing strains
The CAS assay was used to screen the siderophore-producing strains. The 39 isolates were inoculated onto CAS detection solid plates and cultured at 28℃ for 3–5 days to observe the presence of orange transparent circles. The formation of transparent circles indicated positive results, while the absence of the transparent circle was negative results [23].
2.2.2 Quantitative determination of siderophores production in the strains
The siderophores production was quantified by a liquid CAS assay. Specifically, strains producing the orange transparent rings were inoculated into PDB medium and incubated for 3 days in a 28℃, 180 rpm shaker. After the culture, 1.5 mL of fermentation broth, 8000 rpm, centrifuged for 3 minutes, 350 µL of cell-free supernatant (CFS) and PDB medium as a control were added to a 2 mL centrifuge tube, 350 µL of CAS detection solution was added, 3.5 µL of shuttle solution was added, after shaking and mixing and left for 5 minutes. The mixture was added to a 96-well plate and the OD630 of the CFS (As) and PDB medium controls (Ar) was measured at room temperature using a full-wavelength microplate reader. The following formula can be used for quantitative calculations of siderophores production:
Where Ar - the absorbance of the reference (PDA medium) at 630 nm. As - the absorbance of the sample (CFS) at 630 nm [24].
2.3 Identification of the siderophores-producing strain XZ11-1
The siderophores-producing strain XZ11-1 was inoculated on PDA plates and cultured in at 28℃ for 3 days to observe their growth status. Morphological characteristics of mycelia and spores were observed by scanning electron microscopy (SEM, Zeiss Sigma VP, Germany). The physiological and biochemical properties were determined, including the utilization of carbon and nitrogen sources and the tolerance to pH and sodium chloride [25]. Mycelium of strain XZ11-1 were collected and total DNA was extracted using the fungal genomic DNA rapid extraction kit. The primers for RNA polymerase II subunit (ITS) gene were ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 (TCCGCTTATTGATATGC). The primers for amplifying the translation elongation factor 1ɑ(TEF1) gene were EF1 (ATGGGTAAGGARGACAAGAC) and EF2 (GGARGTACCAGTSATCATGTT). PCR system (20 µL): 2 Taq Master Mix 10 µL, the forward primer 1 µL, the reverse primer 1 µL, DNA 1 µL, ddH2O 7 µL. PCR reaction conditions: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30s, 55℃ annealing for 40s, 72℃ extensions for 1 min, 35 cycles, and 72℃ final extensions for 10 min. The amplified PCR products were sequenced using a Sanger-based automated sequencer (Applied Biosystems) Phylogenetic trees were generated using a combination of two genetic loci, namely the TEF1 and ITS5 datasets. The combined data from the two genetic loci were pooled and subjected to analysis using the maximum likelihood method in MEGA Version 7.0.
2.4 Genomic sequencing and Functional annotation of strain XZ11-1.
Strain XZ11-1 was cultured in the PDA solid culture medium at 28◦C for 5 days. Total genomic DNA was extracted using the Rapid Fungal Genomic DNA Extraction Kit (Biotake, Beijing, China). Libraries were constructed using the Hieff NGS® MaxUp II DNA Library Preparation Kit for Illumina®. Their quantification was achieved with the Thermo Qubit 4.0 Fluorescence Quantification Instrument Q33226 from ThermoFisher. We deployed the Illumina High-Throughput Sequencing Platform (HiSeq) to perform the sequencing. FastQC was employed to assay the quality of the raw sequencing data. Furthermore, we utilized PrInSeS-G for sequence correction to mitigate editing errors and the insertion or deletion of small fragments during splicing. GeneMark was used to predict genetic components, such as genes, tRNAs, and rRNAs, among others. The repetitive sequences were identified using Repeat Masker [26]. CRISPR prediction analysis was executed using CRT. Gene protein sequences were aligned with multiple databases, including CDD, KOG, COG, NR, NT, PFAM, Swissprot, and TrEMBL. GO and KEGG annotation was analyzed according to the previous methods [25].
2.5 Effects of different Fe3+ concentrations on the growth of strain XZ11-1
Different concentrations of FeCl3 (10 µM/L, 100 µM/L, 300 µM/L) were added to the PDA solid medium, along with different concentrations of 2,2'-bipyridine (10 µM/L, 100 µM/L, 200 µM/L, 300 µM/L). The blank medium as control. The growth of strain XZ11-1 was observed and recorded.
2.6 Evaluation of siderophores production capability of strain XZ11-1
In the NA medium (3.0 g of NaNO3, 1.0 g of K2HPO4, 0.5 g of KCl, 0.5 g of MgSO4, 30 g of sucrose, pH 7.0-7.2), different concentrations of FeCl3 (0 µM/L, 100 µM/L, 200 µM/L, 400 µM/L, 600 µM/L, 800 µM/L, 1000 µM/L, 2000 µM/L) were added. Then, the already cultured XZ11-1 was inoculated into the NA Medium with a 1.5% inoculum size and incubated at 28°C and 180 rpm for 3 days. Additionally, XZ11-1 was inoculated into NA medium without trivalent iron and cultured for different periods of time. The siderophores production was detected using the CAS (Chrome Azurol S) liquid detection method.
2.7 Detection of iron reducibility of strain XZ11-1 at different time points
Take 1 mL of the liquid culture fermentation broth of XZ11-1 and centrifuge it at 8000 rpm for two minutes. Take 500 µL of the supernatant and then add 25 µL of FeCl3 (1.5 mM/L) solution, 150 µL of sodium acetate buffer (5 M/L), and 75 µL of Chrome Azurol S (CAS) solution (100 mM/L) in sequence. Mix thoroughly and take 200 µL of the mixture into each well of a 96-well plate. Using an Enzyme Labeler, the absorbance changes of the sample at 562 nm wavelength were measured and recorded within a 3-minute period. The corresponding iron reduction activity was then calculated using the following formula:
R = (A3min - A0min) / 3
Where R is the corresponding iron reduction activity of the sample, A0min is the absorbance value (Abs) of the sample at minute 0, and A3min is the absorbance value (Abs) of the sample at minute 3.
2.8 Identification the siderophore types of strain XZ11-1
Strain XZ11-1 was cultured in PDB at 28°C, 180 rpm for 3 days. Then, 1.5 mL of seed culture was transferred to 50 mL of iron-free NA medium and incubated under the same condition for 3 days. Afterwards, 1.5 mL of the fermentation broth was centrifuged at 12000 rpm for 10 minutes to obtain a sterile cell-free supernatant (CFS) for further experiments.
2.8.1 Carboxylates
To detect carboxylate-type siderophores, the Spectrophotometric test was employed [27]. Initially, A mixture of 0.5 mL of NA fermentation filtrate, 0.5 mL of 250 µM/L CuSO4, and 1 mL of acetate buffer at pH 4.0 was prepared. The formation of the copper complex was observed in the spectral range of 190 to 280 nm to determine the maximum absorption. The absorption of the copper complex does not occur at a particular wavelength. The entire wavelength range from 190 to 280 nm was scanned to identify the absorption peaks of the siderophores using a UV-visible spectrophotometer (2802 UV/VIS SPECTROPHOTOMETER, UNICO).
2.8.2 Catecholates
The Arnow's test was used for catecholate-type siderophores detection [28]. Initially, 0.5 mL of the fermentation supernatant was mixed with 0.5 mL of 0.5 M HCl and 0.5 mL of a reagent composed of 10 g of NaNO2 and Na2MoO4·2H2O each, dissolved in 100 mL of water. Subsequently, with the introduction of 0.5 mL of 1 M NaOH, the solution color transferred from yellow to red. The presence of catecholic siderophores was determined by measuring the absorbance at 515 nm using a UV-visible spectrophotometer (2802 UV/VIS SPECTROPHOTOMETER, UNICO).
2.8.3 Hydroxamates
Hydroxamate-type siderophores were detected using the FeCl3 test [29]. Subsequently, 0.5-1 mL of 2% FeCl3 solution was introduced to 0.5 mL of the fermentation supernatants. The appearance of red or purple hues served as an indicator for the presence of hydroxamate siderophores. A hydroxamate nature was confirmed by the observation of an absorption peak within the range of 420–450 nm using a UV-visible spectrophotometer.
2.9 Broad-spectrum antifungal activities assay of strain XZ11-1
To further test the biocontrol potential, ten phytopathogenic fungi were selected to evaluate the broad-spectrum antifungal activities of strain XZ11-1. Including Fusarium oxysporum f. sp. cubense tropical Race 4 (ATCC 76255), Fusarium oxysporum sp. Lycopersici (ATCC 16322), Curvularia lunata (ATCC 42011), Colletotrichum fragariae (ATCC 58718), Colletotrichum gloeosporioides (ATCC 16330) from banana, Botrytis cinerea (ATCC 208829), Colletotrichum gloeosporioides (ATCC 58222) from mango, Fusarium graminearum (ATCC 46779), Pestalogiopsis sp. (ATCC 26275) and Colletotrichum litchi (ATCC 20438). These pathogens are stored at the chinese academy of tropical agricultural sciences. A conventional spot inoculation method was used to test the antifungal activity. A 5 mm mycelial discs of various pathogenic fungi were placed on the edge of PDA plates. The same size discs of strain XZ11-1 were placed on the opposite side. The pathogenic mycelial discs alone were used as a control. All the experiments were performed in triplicate.
2.10 Effect of strain XZ11-1supernatants on the growth of Foc TR4.
To experimentally confirm that strain XZ11-1 inhibit Foc TR4 growth through Siderophores-mediated described as Gu et al.(2020) [30]. We exposed the pathogen to three types of supernatants obtained from strain XZ11-1. Including: (1) supernatants procured from iron-saturated conditions (strain XZ11-1 developed in iron-rich NA medium, where few siderophores are produced but the secretion of other compounds transpires; referred as SNri), (2) supernatants harvested from iron-lacking environments (strain XZ11-1 nurtured in iron-limited NA medium, sparking siderophore production plus other secreted compounds; denoted as SNli), and (3) supernatants from iron-poor conditions that were subsequently fortified with 50 µM FeCl3 (SNre). Despite siderophores being present in this supernatant, they become irrelevant for iron uptake given the iron abundance. Sterilized water served as a control by replacing the supernatant (SNcontrol). Supernatant assays were conducted thrice for all scenarios. We inoculated 20 µL of Foc TR4 spore suspension (adjusted to 1×10^7 spores/mL after counting with a hemocytometer) into 1.8 mL of iron-limited NA medium (diluted 10 times to better reflect the effect of the supernatant) and 200 µl of cell-free supernatant (CFS). The cultures were then incubated at 28°C with shaking at 180 rpm. After 24 hours of incubation, spore counts were determined using a hemocytometer (triplicates for each treatment, and the experiment was repeated three times). Subsequently, we assessed the impact of strain XZ11-1 supernatant on pathogen development, contrasting it with pathogen growth in supernatant-free conditions, using the specific formula: GEtreatment= ((SNtreatment ÷ SNcontrol) − 1) × 100, where SNtreatment is SNli, SNri or SNre. For this computation, we consolidated the mean of supernatant impacts from the three experimental replicates. Recorded values less than zero were indicative of growth suppression, while those greater than zero were suggestive of growth promotion. The outcomes are articulated as the percentage variation in growth. From these measurements, we can determine the net Gravitational Equivalent (GE) of siderophores using the formula: GEnet = GEli - GEre.
2.11 Seed germination experiment
Corn seeds (Huayu 4) were utilized to assess the growth-promoting ability of strain XZ11-1. The corn seeds were procured from the Chengmai Agricultural Material Shop in Haikou, China. Subsequently, the corn seeds were washed, sterilized, and placed on filter paper in petri dishes. The fermentation broth from iron-free NA medium and NA medium (with 600µm/L of FeCl3) was filtered to obtain CFS1 and CFS2, respectively. CFS1, CFS2, and NA medium were diluted 10 times with sterile water. The sterilized corn seeds were then treated with each diluted solution using the following methods: The glass petri dishes containing the corn seeds were incubated at 26 ± 1 ℃, and 3 ml of the treatment solutions were sprayed onto the filter paper daily to maintain seed moisture. Each treatment comprised three replicates, with six seeds in each replicate. Finally, physiological changes were documented, and the experiment was conducted using a completely randomized design under controlled conditions.
2.12 Identification extracellular promotion ability of strain xz11-1
2.12.1 Nitrogen-fixing ability
A diameter of 5 mm fresh mycelial disc was obtained from and placed at the center of Ashby solid medium agar plate. The plates were inoculated in a constant temperature incubator at 28°C cultured for 5 days. If strain XZ11-1 can grow on Ashby solid medium, it indicates that it has nitrogen-fixing ability. Otherwise, it indicates the absence of nitrogen-fixing.
2.12.2 Phosphorus solubilization ability
A diameter of 5 mm fresh mycelial disc from strain XZ11-1 was placed at the center of inorganic phosphorus solid medium agar plate. The plates were inoculated at 28°C cultured for 5 days. The ability of growing on inorganic phosphorus solid medium and generate phosphorus solubilization halos signifies its phosphorus solubilization capability. Conversely, the absence of growth indicates the lack of this ability.
2.12.3 Potassium solubilization ability
Following the method outlined in reference 2.12.1, the fresh mycelial disc of strain XZ11-1 were placed onto potassium solubilization solid medium agar plates. During the cultivation period, observe the growth of XZ11-1 on the plates and the formation of transparent zones.
2.12.4 IAA production ability
The Salkowski colorimetric method was used to measure IAA production ability. A 5mm diameter agar plug was inoculated into King B liquid medium with 100mg/L tryptophan. The medium was then incubated at 28℃, 180 rpm for 24h. Subsequently, 350 µL of the fermentation broth was mixed with 700 µL of Salkowski’s reagent (composed of 1 mL of 0.5 M FeCl3 and 50 mL of 35% perchloric acid), wrapped in aluminum foil and left in the dark for 30 minutes. The depth of pink color development was indicative of the amount of IAA produced, with a deeper color higher the IAA production.
2.13 Colonization of strain XZ11-1 on banana roots
The roots of banana seedlings treated with strain XZ11-1 were observed using a scanning electron microscope (SEM, TM 4000 Plus, Hitachi, Tokyo, Japan). First, we conducted a hydroponic experiment, dividing the banana seedlings into two groups, one group was treated with sterile water, while the other group was treated with fermentation of strain XZ11-1 (Strain XZ11-1 was fermented in PDB at 28°C, 180 rpm for 3 days). Three plants in each group. After 7 days of cultivation at room temperature, the banana roots were cut uniformly into pieces with 5 millimeters in length. Next, we soaked the samples in 2.5% (v/v) glutaraldehyde and fixed for 4 hours, rinsed with PBS four times with 20 minutes for each time. Then, the samples were dehydrated using alcohol solutions of different concentrations (30%, 50%, 70%, 90%, and 100%). Subsequently, the samples were stored at -80°C for 4 hours. Finally, the dried samples were coated with a thin layer of gold and observed using SEM.
2.14 Assessment of plant growth promotion and biocontrol efficiency
A pot experiment was conducted to assess the effectiveness of strain XZ11-1 in controlling banana wilt disease and its growth-promoting effect on banana plants. Strain XZ11-1 was inoculated into 1 liter of sterilized NA Medium with 300 milliliters of iron-free solution. The culture was fermented at 28°C, 180 rpm for 3 days. The fermentation broth was then filtered through four layers of sterile gauze and spores was adjusted to 1×106 CFU/mL using sterile water. Foc TR4 was inoculated in PDB at 28°C, 180 rpm for 5 days. The culture was then filtered to obtain spore suspension of Foc TR4. The spore suspension was diluted to 1×106 CFU/mL. Healthy banana seedlings (Musa AAA group, Cavendish cv. Brazil) with uniform growth were selected and transplanted into pots (diameter 15 cm). After one week of cultivation in the greenhouse at a temperature of 28°C ± 2°C, the seedlings were divided into four groups. The experiment consisted of four treatments, including: XZ11-1 fermentation broth (1×105 CFU/g soil) + Foc TR4 (1×105 CFU/g soil), Foc TR4 (1×105 CFU/g soil), iron-free NA Medium, and XZ11-1 fermentation broth (1×105 CFU/g soil). a mixture of 100 milliliters of each treatment was added to the roots of the banana seedlings every week. All treatments were conducted in triplicate with 5 pots in each repeat. The yellowing symptom of banana leaves was assessed at 45 days post-inoculation (dpi), and the disease indexes were recorded according to Zhang et al. (2022) [31]. At 45 days post-inoculation (dpi), various physiological parameters of banana seedlings were assessed, such as chlorophyll content, stem diameter, plant height, leaf area, leaf thickness, dry weight, fresh weight, and leaf count, as outlined by Zhang et al. (2021)[32].2.15 Statistical analysis
All experimental procedures were carried out using a completely randomized design. Each data point represents the mean ± standard deviation (SD) obtained from a minimum of three biological replicates. Data analysis was performed using SPSS software, and the Duncan multiple range test was conducted at a statistical significance level set at P < 0.05.