Chlorogenic acid alleviates IPEC-J2 pyroptosis induced by deoxynivalenol through inhibiting the activation of NF-κB/NLRP3/Capase-1 pathway

doi:10.21203/rs.3.rs-4346087/v1

Download PDF

Research Article

Chlorogenic acid alleviates IPEC-J2 pyroptosis induced by deoxynivalenol through inhibiting the activation of NF-κB/NLRP3/Capase-1 pathway

https://doi.org/10.21203/rs.3.rs-4346087/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Deoxynivalenol (DON) is a severely polluted mycotoxins in feed ingredients, and methods for reducing its toxicity have become a significant direction of research. Chlorogenic acid (CGA) in some plants is an active polyphenol with anti-inflammatory and antioxidant properties and a protective effect on animal intestinal health. The effects of CGA on DON-induced pyroptosis of the intestinal porcine epithelial cell line-J2 (IPEC-J2) and its potential mechanism were explored in this study.

Results

The results indicated that exposure to DON at 2500 ng/mL significantly increased the mortality of IPEC-J2 cells, accompanied by typical pyroptosis features, including breakage of cellular DNA, damage to cell membrane integrity, and an increase in the extracellular concentration of positive ions (Ca²⁺ and K⁺) and pro-inflammatory cytokines (IL-1β and IL-18). Nevertheless, DON-induced pyroptosis was alleviated by CGA. Additionally, the exposure of DON promoted the mRNA expression of initiating signaling factors relevant to pyroptosis (including TNF, MDP, NOD2, TLR4, and NF-κB), enhanced the mRNA and protein levels of activation signaling factors (including NLRP3, ASC, Caspase-1, and GSDMD), and increased the level of ROS. Among them, the NF-κB/ROS/NLRP3/Capase-1 pathway was identified as the key factor in the dual-signaling pathway. Our findings suggest that CGA pretreatment simultaneously inhibits the activation of both the initiating and activation signals related to pyroptosis.

Conclusion

In short, CGA can alleviate DON-induced pyroptosis of IPEC-J2 cells through inhibiting the activation of NF-κB/ROS/NLRP3/Capase-1 pathway.

Chlorogenic acid

Deoxynivalenol

IPEC-J2 cells

Pyroptosis

Signaling pathway

Feed safety has a crucial impact on livestock health, and a series of problems caused by mycotoxin contamination in the feed have been investigated by animal husbandry and the feed industry [1, 2]. Among them, deoxynivalenol (DON) is a severely polluted mycotoxin threatening the safety of human food and animal feed because of its high detection rate in various grains and stable chemical properties [3, 4]. DON has multiple toxic effects and is a carcinogen whose primary target organ is the intestine [5]. After DON is ingested, the intestinal tract serves as the first barrier to block its entrance to the body not only because of its special location and function but also because it has strong resistance and immune response to DON stimulation [6, 7]. Swine are the most sensitive livestock to DON, and the intestinal porcine epithelial cell line-J2 (IPEC-J2) is a typical cell line used for studying intestinal injury. DON has pro-inflammatory and immunoregulatory effects on IPEC-J2 cells, inducing cellular damage such as oxidative damage, inflammation, even apoptosis [8, 9].

Pyroptosis, which is known as a programmed cell death, is closely related to inflammation and is triggered by an imbalance in intracellular and extracellular homeostasis associated with innate immunity [10, 11]. NOD-like receptor thermal protein domain-associated protein 3 (NLRP3) is a recognition receptor with an intracellular pattern that detects not only pathogenic microorganisms but also endogenous danger signals and certain metabolites [12]. After NLRP3 is activated, apoptosis-associated speck-like protein containing a CARD (ASC) is recruited. Subsequently, NLRP3 and the Caspase-1 precursor assemble to form a multiprotein complex known as the NLRP3 inflammasome, also referred to as caspase-1-dependent inflammasome. Caspase-1 can be activated by various stimulation signals in vivo and in vitro (including extracellular ATP, RNA viruses, bacteria, and mycotoxins) through different pathways, thereby inducing pyroptosis [13, 14]. Swanson et al. [15] proposed a dual-signaling pattern of pyroptosis (Fig.S1). The initiating signal (signal 1) involves the recognition of microbial ligands or cytokine by Toll-like receptors (TLRs), which subsequently activate the nuclear factor kappa-B (NF-κB) pathway, ultimately upregulating the level of interleukin-1β (IL-1β) precursors and NLRP3 proteins. Meanwhile, muramyl dipeptide (MDP) and NOD-like receptor-2 (NOD 2) are also involved in the initiation step [16]. The activation signal (signal 2) promotes the assembly and activation of the NLRP3 inflammasome complex under pathological conditions, thereby leading to the activation of caspase-1 and the overflow of IL-1β and interleukin-18 (IL-18), ultimately inducing cell pyroptosis [17]. Multiple studies have shown that DON can induce pyroptosis in various cell lines. However, the mode of initiation and activation is not clear [18, 19].

Inhibiting the activation and development of pyroptosis could reduce the pathological damage caused by immune inflammation [12, 20]. Hence, intervening in pyroptosis mediated by the NLRP3 inflammasome may represent a new strategy to alleviate the toxicity of DON. Chlorogenic acid (CGA), condensed by caffeic acid and quinic acid, is a phenylpropanoid mainly found in honeysuckle, Eucommia, coffee, and tea [21]. Multiple in vivo and in vitro experiments have displayed that CGA has various biological activity, including anti-inflammatory, antioxidant, antibacterial, and intestinal protection [22–24]. CGA has been reported that it can reduce the inflammatory response of ulcerative colitis induced by LPS and ATP through inhibiting the NF-κB/NLRP3 pathway [25]. However, it remains unclear whether CGA alleviates DON-induced pyroptosis by inhibiting NLRP3 activation. This study aimed to analyze the effects of CGA on DON-induced pyroptosis and its potential mechanism.

2.1 Reagents and antibodies

DON was obtained from Triplebond Company (Guelph, Ontario, Canada). CGA (purity > 98%) was obtained from Macklin Company (Shanghai, China). Rabbit IL-18 polyclonal antibody and Caspase-1 monoclonal antibody was supplied by Beyotime Biotechnology (Shanghai, China). Rabbit NLRP3 monoclonal antibody and IL-1β polyclonal antibody were supplied by Proteintech Group Inc (Wuhan, China). Rabbit β-actin antibodies was purchased from Abmart Shanghai Co.,Ltd (Abmart, China).

2.2 Cell culture

IPEC-J2 cells were cultured in a complete medium (Solarbio, China) containing 10% fetal bovine serum and 1% penicillin–streptomycin combination (Solarbio, China). The cells were routinely cultured in an incubator at 37°C with 5% carbon dioxide (CO₂).

2.3 CCK-8 and MTT

IPEC-J2 cells in the logarithmic phase exposed to DON at different concentrations (0, 500, 1000, 1500, 2000, 2500, and 3000 ng/mL) for various cultivation times (12, 24, and 48 h). Six replicates were used for each treatment. Next, 10 µL CCK-8 and 15 µL MTT were added to 96-well plates, following the instructions provided with the CCK8 and MTT detection kits (Solarbio, China), respectively. After a certain period of cultivation and corresponding treatment, the absorbance of CCK-8 and MTT were detected at 450 and 490 nm, respectively. Subsequently, the cell viability and mortality of each treatment group were calculated using specific formulas.

2.4 Lactate dehydrogenase (LDH) activity assay

After culturing to an appropriate density, IPEC-J2 cells were exposed to DON at 1500, 2000, 2500, and 3000 ng/mL for 24 h, with six replicates for each treatment. The content of LDH in the supernatant was detected according to the instructions of LDH kits (Beyotime, China).

2.5 ROS assay by dichlorofluorescin diacetate (DCFH-DA)

After culturing IPEC-J2 cells with different treatments for 24 h, 1 mL of 10 µM DCFH-DA working solution (MedChemExpress, USA) was added to each confocal dish and incubated for 20 min. Subsequently, 1 mL of the cell culture medium was added, and images were captured using a confocal laser microscope (sAndorra, USA).

2.6 Lyso-Tracker Red fluorescent (LTR)

The Lyso-Tracker Red probe (Solarbio, China) was used to detect intracellular lysosomes. JPEC-J2 cells exposed to DON were coincubated for 1 h with a proper lysosomal red fluorescent staining solution, prepared according to the provided instructions. After discarding the staining solution and rinsing with PBS buffer, staining images were observed and captured using a fluorescence microscope.

2.7 Scanning electron microscope (SEM)

IPEC-J2 cells from each treatment group were fixed in the dark using a specialized fixing solution at 20–25°C for 30 min. Next, a series of steps were performed, including rinsing with 0.1 M phosphate buffer, gradient dehydration using increasing concentrations of ethanol, replacement with isoamyl acetate, drying at the CO₂ critical point, and gold plating using an ion sputter coater. Finally, images were observed and captured using an SU8100 SEM (Hitachi, Japan).

2.8 Acridine orange/ethidium bromide (AO/EB) dual staining

According to the instructions of the AO/EB double staining kits (Yuanye-Bio China), the dyeing buffer was prepared. IPEC-J2 cells from each treatment group were collected and resuspended in the dyeing buffer. Subsequently, 5 µL of AO dye solution and 5 µL of EB dye solution were successively added and mixed. The mixture was then incubated at 4°C in the dark for 10–20 min. After washing with PBS buffer, images were observed and captured using confocal microscope (Andorra, America), and the fluorescence intensity was analyzed using ImageJ for Windows (National Institutes of Health, USA).

2.9 Terminal deoxynucleotidyl transferase–mediated dUTP-biotin nick end labeling assay (TUNEL)

IPEC-J2 cells from each treatment group were fixed with 4% paraformaldehyde for 30 min. Subsequently, they were incubated with 100 µL of TUNEL reaction solution (Beytome, China) at 37°C for 60 min, after which the reaction was terminated. After washing with PBS buffer, the cells were sealed with antifade mounting medium (Beytome, China). Finally, the results were observed using a confocal fluorescence microscope (NIKON, Japan).

2.10 Quantitative real-time PCR (qRT-PCR)

Trizol (Ambion, USA) was used to isolate total RNA, and reverse transcription was performed using PrimeScript™ RT kits (Shiga, Japan). PCR operation and data calculation were conducted as described in our previous study [8]. All primers were synthesized by Sangon Biotech (Shanghai, China) and listed in Table 1.

Table 1

Gene-specific primer of related genes
Gene	Sequence of primer pairs(5’→3’)	Size (bp)
GAPDH	ATGGTGAAGGTCGGAGTGAAC/GTGGGTGGAATCATACTGGAACA	153
TNF	ACCACGCTCTTCTGCCTACTG/GACGGGCTTATCTGAGGTTTGAGA	132
ASC	CGTGACATCGGCATGAAGGAG/GTGCTGGTTTGTTGTCTGCTTTC	118
IL-18	CCAGGGACATCAAGCCGTGTT/TGGTTACTGCCAGACCTCTAGTGA	122
IL-1β	AAGTGGTGTTCTGCATGAGCTTT/CAGGGTGGGCGTGTTATCTT	125
Caspase-1	ACTCTCCACAGGTTCACAATCT/TCTGAAGACGCAGGCTTAACT	120
NLRP3	AGGAGGAGGAAGAGGAGATAGAG/GGACTGAGAAGATGCCACTAC	144
GSDMD	CGGAAGAAGACGGTCACCATC/ATGTCCCAGTCAGAACCAATCAC	83
TLR4	TGCAGAAGTTGGAGAAGTCCC/CCTCCCACTCCAGGTAGGTAT	84
NOD2	TGTGAAGGCGAATGGGTTGG/GTACTTCTTACAGGCAGCATCTTC	100
MDP1	GTCACGCACTTTGAGAGGTTG/GGACATGAACACAGGCAACAC	124
NF-κB	ATGTGGGACCAGCAAAGGTT/CACCATGTCCTTGGGTCCAG	134

2.11 Western blotting

RIPA buffer and PMSF (Beyotime, China) were used to lyse cells to obtain the total proteins of cells. Following isolation by SDS-PAGE gels, equal amounts of denatured protein were transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, France). Next, the membranes were incubated with primary antibodies at 4°C overnight, followed by secondary antibodies at room for 1 h. Finally, after the image was developed using the FX7 Vilber Lourmat imaging system (Fusion, France), the optical densities of the target protein bands were evaluated using Image J for Windows. β-actin was concurrently tested as an internal reference in this study.

2.12 Immunofluorescence

IPEC-J2 cell slides from each corresponding treatment were fixed with 4% paraformaldehyde for 30 min. After treatment with TritonX-100 and 5% bovine serum albumin, the slides were incubated with primary antibodies at 4°C overnight and then with secondary antibodies for 1 h. Subsequently, the slides were sealed with antifade mounting medium (Beytome, China) and observed using a confocal fluorescence microscope (NIKON, Japan).

2.13 Statistical analysis

The significant of experimental data were analyzed by ANOVA via SPSS 20.0 for Windows, and Mean ± SD was used to present data.

3.1 DON induces pyroptosis

This study is the first to evaluate the toxicity of DON exposure concentration and time on IPEC-J2 cells by assessing cell activity, membrane integrity, and several factors related to pyroptosis. The results from CCK-8 (Fig. 1a) and MTT (Fig. 1b) assays revealed that cell viability was inversely proportional to the exposure concentration of DON, and cell mortality increased with higher concentrations. In addition, the longer the exposure time at the same concentration, the higher the mortality rate. Based on these results, a 24-h exposure time to DON was chosen for subsequent studies.

The effects of DON exposure on several pyroptosis-related factors are displayed in Fig. 2. Compared with the control group, the LDH release, the levels of pro-IL-1β and IL-1β, the extracellular concentrations of Ca²⁺ and K⁺, and the enzyme activity of caspase-1 and caspase-4 significantly augmented, and in direct proportion to DON concentration (P < 0.05). Differently, in contrast to those in the group treated with DON at 2500 ng/mL, the data of pro-IL-1β and LDH in the group treated with DON at 3000 ng/mL were significantly decreased (P < 0.01). Typical fluorescence images of lysosomes (Fig. 3) revealed a significant decrease in fluorescence intensity of intracellular lysosome (P < 0.05) caused by DON exposure, which was inversely proportional to the concentration of DON, indicating intracellular lysosome were destroyed by DON exposure. The SEM results (Fig. 4) revealed that when DON concentration at 2000 ng/mL, the cells exhibited swelling, and vesicles formed owing to the presence of numerous cell protrusions. The cell membrane showed extensive damage, with numerous pores of varying sizes observed, consistent with pyroptosis features. In contrast, the cell membrane in the group treated with DON at 2500 ng/mL exhibited more severe damage, accompanied by more holes and vesicles (Fig. 4C). Therefore, a concentration of 2500 ng/mL of DON was used for subsequent experiments.

3.2 CGA alleviates injury to IPEC-J2 cells induced by DON

To determine the optimal concentration of CGA for the subsequent experiments, the cells were exposed to DON at 2500 ng/mL for 24 h after pretreatment with CGA (0–100 µM) for 4 h. The results of CCK-8 showed that cell viability was highest when the pretreatment concentration of CGA was 80 µM, indicating that CGA at 80 µM had the strongest protective effect against DON (Fig. 5A).

Accordingly, IPEC-J2 cells were divided into four treatment groups: control, DON (2500 ng/mL), CGA (80 µM), and CGA + DON (80 µM CGA + 2500 ng/mL DON). The results of the LDH assay demonstrated that LDH activity in the extracellular fluid (Fig. 5B) was significantly increased (P < 0.01) after exposure to DON. However, these damages could be significantly alleviated (P < 0.01) by CGA. AO/EB dual staining was used to observe the apoptosis of IPEC-J2 cells under a fluorescence microscope, and representative photos are shown in Fig. 5C. Several normal cells were dyed green by AO in the control and CGA groups, with intact nuclei and clear boundaries, and almost no positive red EB staining, indicating no obvious apoptosis. After exposure to DON, the quantity and intensity of red fluorescence in apoptotic cells significantly increased, whereas in normal cells, they significantly decreased. Although red fluorescence was still visible in the CGA + DON group, it was apparently lessened in the DON group.

3.3 CGA relieves IPEC-J2 pyroptosis induced by DON

Compared with apoptosis, the most prominent features of pyroptosis include degradation of chromosomal DNA, loss of cell membrane integrity, and the overflow of IL-1β and IL-18 from the cytoplasm. Positive green fluorescent nuclei stained by TUNEL represent dead IPEC-J2 cells with broken DNA. The intensity of green fluorescence in the DON group was noticeably higher than that in the other three groups (Fig. 6A), indicating that CGA can reverse the DNA damage induced by DON. Compared with the control and CGA groups, DON addition increased the mRNA levels of GSDMD (P < 0.01) (Fig. 6B), and the enzyme activity of caspase-1 and caspase-4, but pretreatment with CGA inhibited these variations (P < 0.05) (Fig. 6CD). In addition, pretreatment with CGA reversed the increases in the concentrations of extracellular Ca²⁺ and K⁺ induced by DON (Fig. 6EF).

ELISA, qRT-PCR, Western blotting, and immunofluorescence were used in this study to assess changes in key proinflammatory factors related to pyroptosis. In comparison with the control group, DON exposure significantly increased the concentrations of extracellular pro-IL-1β, IL-1β, pro-IL-18, and IL-18 (P < 0.05) (Fig. 7A–D), as well as the mRNA and protein levels of IL-1β and IL-18 (Fig. 7E–H). These findings suggest that DON can stimulate the release of intracellular cations and proinflammatory elements, thereby inducing pyroptosis. However, pretreatment with CGA significantly alleviated DON-induced changes (P < 0.01).

3.4 CGA inhibits DON-induced pyroptosis via a dual-signaling pathway

To further determine the inhibitory pathway of CGA on pyroptosis induced by DON, this study examined the mRNA levels of key signaling factors in the priming and activation pathways of pyroptosis. The results indicated that DON exposure significantly increased the mRNA levels of TNF, MDP, NOD2, TLR4, and NF-κB related to the priming signaling of pyroptosis (P < 0.05) compared with the control and CGA groups. However, pretreatment with CGA significantly reversed these changes (P < 0.05) (Fig. 8A–E). Confocal microscopy was used to detect the relative fluorescence intensity of ROS, revealing that DON exposure markedly increased the fluorescence intensity of ROS (P < 0.01) compared with the control group, whereas CGA pretreatment significantly inhibited the excessive increase of ROS induced by DON (P < 0.05) (Fig. 8F–G). The results of immunofluorescence illustrated that the fluorescence intensity of NF-κB in DON group was significantly higher than that in the other three groups (Fig. 8H), indicating that DON can promote the high expression of NF-κB, and the addition of CGA can reverse these changes.

The data from qRT-PCR, Western blot, and immunofluorescence demonstrated that CGA pretreatment significantly inhibited the higher mRNA and protein expression levels of caspase-1, ASC and NLRP3 induced by DON exposure (Fig. 9). Meanwhile, DON exposure notably increased the enzyme activity of caspase-1/4 (Fig. 7A) compared with the control and CGA + DON groups, indicating that the activation of the NLRP3 inflammasome and caspase-1 induced by DON were inhibited by CGA.

4.1 CGA alleviates injury to IPEC-J2 cells induced by DON

4.2 DON induces IPEC-J2 cell pyroptosis by participating in the priming and activation signaling pathways

Pyroptosis is a crucial immune response in the body and is extensively involved in the occurrence and progression of numerous illnesses [13, 26, 27]. DON is a mycotoxin with the widest pollution rate and range globally. Although research has shown that DON exposure can induce apoptosis and autophagy [28–30], few studies have explored its role in pyroptosis induced by DON, particularly regarding the underlying mechanism and activation pathway.

The fundamental characteristics of pyroptosis are inflammasome formation and the outflow of IL-1β and IL-18. Noteworthy morphological features include the degradation of chromosomal DNA, the loss of cell membrane integrity, and the release of cytoplasmic substances into the extracellular space [10]. IPEC-J2 cells serve as the most typical cell line for studying DON-induced enterotoxicity. This study constructed a model of DON-induced pyroptosis in IPEC-J2 cells firstly, focusing on parameters such as survival rate, membrane integrity, ultrastructure, and alterations in pyroptosis-related factors. The results indicate a noticeable decline in survival rate of IPEC-J2 cells when DON exposure at a concentration of 2500 ng/mL for 24 h. This exposure led to typical pyroptosis characteristics, including the formation of pores in the cell membrane and the release of positive ions and inflammatory factors. Moreover, cell damage intensified with increasing concentrations of DON. However, the levels of LDH and pro-IL-1β significantly decreased at 3000 ng/mL compared with 2500 ng/mL. This discrepancy may be attributed to the excessively high cell mortality rate, which could interfere with the final experimental results. Inflammasome and caspase-1 are activated by various stimuli in vivo and in vitro through different pathways, inhibiting the reaction of endogenous bioactive metabolites and thereby induced pyroptosis. In this study, exposure to DON-induced cation efflux, ROS production, and lysosome damage, which may affect the activation and occurrence of pyroptosis.

For pyroptosis, a dual-signaling mode involving the initiation and activation of the NLRP3 inflammasome has been proposed [15]. Based on the DON-induced IPEC-J2 pyroptosis model, this study investigated the roles of priming and activating signaling factors in DON-induced pyroptosis. The consequences illustrated that DON increased the mRNA level of NF-κB by upregulating priming signaling factors, including TNF, MDP, NOD2, and TLR4. However, DON could directly cause the excessive production of ROS, promoting the assembly and activation of the NLRP3 inflammasome complex under oxidative stress and NF-κB, thereby activating caspase-1. On the other hand, DON could directly cause the excessive production of ROS, promoting the expression of activating signaling factors, including ACS, NLRP3 and caspase-1. Activating caspase-1 promoted pro-IL-1β and pro-IL-18 to be cleaved in IL-1β and IL-18. Conversely, it promoted the the GSDMD to be cut to GSDMD-N domain, which oligomerized to form membrane pores, resulting in the overflow of IL-1β and IL-18, disruption of osmotic potential, and ultimately cell swelling and eventual pyroptosis. In summary, DON can induce IPEC-J2 cell pyroptosis by participating in two pathways: priming and activation.

4.3 CGA inhibits DON-induced pyroptosis through the NF-κB/ROS/NRPR3 signaling pathway

Given the serious contamination of DON in grains and feed materials, there is an urgent need to develop a new type of feed additive capable of effectively reducing DON toxicity and enhancing the body’s immunity to alleviate the damage it causes to animals. DON, being a weakly polar mycotoxin, presents challenges for removal using conventional physical adsorbents and chemical methods [31]. Therefore, nutritional regulation has become an important research direction to alleviate DON toxicity [32–34]. Inhibiting the activation of the NLRP3 inflammasome can improve the pathological damage caused by immune inflammation [2, 35]. Therefore, intervening in the pyroptosis pathway mediated by the NLRP3 inflammasome may become a new strategy and therapeutic target for alleviating DON toxicity.

CGA is a polyphenol found in various plant tissues and foods [36]. Several studies have indicated that CGA has a variety of biological effects, including antioxidant, antibacterial, anti-inflammatory, analgesic, hepatoprotective, and anticancer effects [37, 38]. Our laboratory has previously found that CGA addition can increase the anti-inflammatory and antioxidant properties of the rabbit intestine [21]. CGA protects against intestinal oxidative damage induced by DON by “clearing” excessive ROS. In addition, it alleviates the inflammatory response of ulcerative colitis induced by LPS and ATP by inhibiting NF-κB/NLRP3 pathway [25]. However, it remains unknown whether CGA can alleviate DON-induced pyroptosis through a dual-signaling pathway mode. The results of this study indicate that DON exposure can activate the NLRP3 inflammasome and induce pyroptosis through a dual-signaling pattern. However, CGA intervention can alleviate DON-induced pyroptosis by inhibiting both priming and activation signals, particularly targeting the NF-κB/ROS/NLRP3 pathway. Based on these findings, a schematic diagram illustrating CGA’s intervention in DON-induced pyroptosis is presented in Fig. 10.

In summary, DON exposure can activate the NLRP3 inflammasome and induce pyroptosis through a dual-signaling pattern. However, CGA intervention can alleviate DON-induced pyroptosis by inhibiting both priming and activation signals, particularly targeting the NF-κB/ROS/NLRP3 pathway.

ASC

Apoptosis-associated speck-like protein containing a CARD

CGA

Chlorogenic acid

DON

Deoxynivalenol

GSDMD

Gasdermin D

Interleukin

IPEC-J2

Intestinal porcine epithelial cell line-J2

LDH

Lactate dehydrogenase

MDP

muramyl dipeptide

NF-κB

Nuclear factor kappa-B

NLRP3

NOD-like receptor thermal protein domain associated protein 3

NOD 2

NOD-like receptor-2

TLR4

Toll-like receptors 4

TNF

Tumor necrosis factor.

Acknowledgments

Not applicable.

Funding

This study was supported by the National Natural Science Foundation of China (32373062) and the Natural Science Foundation of Shandong Province (ZR2023MC144). Funds of Shandong Province Modern Agricultural Technology System Innovation Team Program (SDAIT-21-10).

Ethics approval and consent to participate

Not applicable.

Consent for publication

All authors read and agree to the content of this paper and its publication.

Conflict of interest

All authors declare that there are no conflicts of interest.

Availability of data and materials

The data used to support the findings of this study are available from the corresponding author upon reasonable request.

Author contributions

Xue Y. performed the experiments and drafted the manuscript; Li F. designed the experiments; Li R. and Zhang X. assisted in experimental preparation; Guo H. provided the analysis tools; Wang C. acquired funds and revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Author details

¹College of Animal Veterinary Medicine, Shandong Agricultural University, Shandong, China. ²College of Animal Science and Technology, Shandong Agricultural University, Shandong, China.

Author information

Yanmei Xue., email: [email protected]; Fuchang Li., email: [email protected];

Rui Li., email: [email protected]; Xinru Zhang., email: [email protected];

HuiJ Guo., email: [email protected]; Chunyang Wang., email: [email protected].

Thapa A, Horgan KA, White B, Walls D. Deoxynivalenol and Zearalenone Synergistic or Antagonistic Agri-Food Chain Co-Contaminants?. Toxins. 2021; 13(8): 561.
Xu R, Shandilya UK, Yiannikouris A, Karrow NA. Traditional and emerging Fusarium mycotoxins disrupt homeostasis of bovine mammary cells by altering cell permeability and innate immune function. Anim Nutr. 2023; 12: 388-97.
Abraham N, Schroeter KL, Zhu Y, Chan J, Evans N, Kimber MS, et al. Structure–function characterization of an aldo–keto reductase involved in detoxification of the mycotoxin, deoxynivalenol. Sci Rep. 2022; 12: 14737.
Holanda DM, Kim SW. Mycotoxin Occurrence, Toxicity, and Detoxifying Agents in Pig Production with an Emphasis on Deoxynivalenol. Toxins. 2021; 13(2): 171.
Cimbalo A, Alonso-Garrido M, Font G, Manyes L. Toxicity of mycotoxins in vivo on vertebrate organisms: A review. Food Chem Toxicol. 2020; 137: 111161.
Ghareeb K, Awad WA, Bohm J, Zebeli Q. Impacts of the feed contaminant deoxynivalenol on the intestine of monogastric animals: Poultry and swine. J Appl Toxicol. 2015; 35: 327–37.
Wang C, Huang L, Wang P, Liu Q, Wang J. The Effects of Deoxynivalenol on the Ultrastructure of the Sacculus Rotundus and Vermiform Appendix, as Well as the Intestinal Microbiota of Weaned Rabbits. Toxins. 2020; 12: 569.
Liu Q, Li F, Huang L, Chen W, Li Z, Wang, C. FumDSB Can Reduce the Toxic Effects of Fumonisin B1 by Regulating Several Brain-Gut Peptides in Both the Hypothalamus and Jejunum of Growing Pigs. Toxins. 2021; 13: 874.
Zha A, Liao S, Tan B, Liao P. Integrated lncRNA transcriptomics, proteomics, and metabolomics to identify early cellular response variation in deoxynivalenol-treated IPEC-J2 cells. Food Chem Toxicol. 2023; 177: 113863.
Yu P, Zhang X, Liu N, Tang L, Peng C, Chen X. Pyroptosis: mechanisms and diseases. Signal Transduct Tar. 2021; 6: 128.
Xu J, Nunez G. The NLRP3 inflammasome: activation and regulation. Trends in biochemical sciences. 2023; 48(4): 331-44.
Coll RC, Schroder K, Pelegrín P. NLRP3 and pyroptosis blockers for treating inflammatory diseases. Trends Pharmacol Sci. 2022; 43: 653-68.
Mázló A, Jenei V, Burai S, Molnár T, Bácsi A, Koncz G. Types of necroinflammation, the effect of cell death modalities on sterile inflammation. Cell Death Dis. 2022; 13: 423.
Evavold CL, Hafner-Bratkovi I, Devant P, Ngwa EM, Boršić E, Doench JG, et al. Control of gasdermin D oligomerization and pyroptosis by the Ragulator-Rag-mTORC1 pathway. Cell. 2021; 184: 4495–511.
Swanson KV, Deng M, Ting JPY. The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nat Rev Immunol. 2019; 19: 477-89.
Li C, Xu XY, Wang Z, Wang Y, Luo L, Cheng J, et al. Exercise ameliorates post-stroke depression by inhibiting PTEN elevationmediated upregulation of TLR4/NF-κB/NLRP3 signaling in mice. Brain Res. 2020; 1736: 146777.
Calbay O, Padia R, Akter M, Sun L, Li B, Qian N, et al. ASC/inflammasome independent pyroptosis in ovarian cancer cells through translational augmentation of caspase-1. iScience. 2023; 26: 108408.
Mao X, Li J, Xie X, Chen S, Huang Q, Mu P, et al. Deoxynivalenol induces caspase-3/GSDME-dependent pyroptosis and inflammation in mouse liver and HepaRG cells. Arch Toxicol. 2022; 70: 12968−81.
Qu J, Zhang S, He W, Liu S, Mao X, Yin L, et al. Crucial Function of Caveolin-1 in Deoxynivalenol-Induced Enterotoxicity by Activating ROS-Dependent NLRP3 Inflammasome Mediated Pyroptosis. J Agri Food Chem. 2022; 70: 12968−81.
Yang Y, Wang H, Kouadir M, Song H, Shi F. Recent advances in the mechanisms of NLRP3 inflammasome activation and its inhibitors. Cell Death Dis. 2019; 10: 128.
Chen J, Song Z, Ji R, Liu, Y, Zhao, H, Liu, L, Li F. Chlorogenic Acid Improves Growth Performance of Weaned Rabbits via Modulating the Intestinal Epithelium Functions and Intestinal Microbiota. Front Microbiol. 2022; 13: 1027101.
Miao M, Xiang L. Pharmacological action and potential targets of chlorogenic acid. Adv Pharmacol. 2020; 87: 71-8.
Grzelczyk, J, Szwajgier D, Baranowska-W´ojcik E, Budryn G, Zakłos-Szyda M, Sosnowska B. Bioaccessibility of coffee bean hydroxycinnamic acids during in vitro digestion influenced by the degree of roasting and activity of intestinal probiotic bacteria, and their activity in Caco-2 and HT29 cells. Food Chem. 2022; 392: 133328.
Fakhar-e-Alam Kulyar M, Yao W, Ding Y, Du H, Mo Q, Pan H, et al. Chlorogenic acid suppresses mitochondrial apoptotic effectors Bax/Bak to counteract Nod‐like receptor pyrin domain 3 (NLRP3) inflammasome in thiram exposed chondrocytes. Phytomedicine. 2022; 95: 153865.
Zeng J, Zhang D, Wan X, Bai Y, Yuan C, Wang T, et al. Chlorogenic Acid Suppresses miR-155 and Ameliorates Ulcerative Colitis through the NF-κB/ NLRP3 Inflammasome Pathway. Mol Nutr Food Res. 2020; 64: 2000452.
Zeng Z, Li G, Wu S, Zuo W. Role of pyroptosis in cardiovascular disease. Cell Proliferat. 2019; 52: 12563.
Wei X, Xie F, Zhou X, Wu Y, Yan H, Liu T, et al. Role of pyroptosis in inflammation and cancer. Cell Mol Immunol. 2022; 19: 971-92.
Cai G, Guerrero-Netro HM, Bian J, Oswald LP, Price C, Alassane-Kpembi I. Real-life exposure to Fusarium toxins deoxynivalenol and zearalenone triggers apoptosis and activates NLRP3 inflammasome in bovine primary theca cells. Mycotoxin Res. 2023; 39: 367–77.
Liu D, Wang Q, He W, Ge L, Huang K. Deoxynivalenol aggravates the immunosuppression in piglets and PAMs under the condition of PEDV infection through inhibiting TLR4/NLRP3 signaling pathway. Ecotox Environ Safe. 2022; 231: 113209.
Liu S, Mao X, Ge Lei, Hou L, Le Guannan, Gan F, et al. Phenethyl isothiocyanate as an anti-nutritional factor attenuates deoxynivalenol-induced IPEC-J2 cell injury through inhibiting ROS-mediated autophagy. Anim Nutr. 2022; 8: 300-9.
Li F, Wang J, Huang L, Chen H, Wang C. Effects of Adding Clostridium sp. WJ06 on Intestinal Morphology and Microbial Diversity of Growing Pigs Fed with Natural Deoxynivalenol Contaminated Wheat. Toxins. 2017; 9: 383.
Chen J, Zhou Z, Wu N, Li J, Xi N, Xu M, et al. Chlorogenic acid attenuates deoxynivalenol-induced apoptosis and pyroptosis in human keratinocytes via activating Nrf2/HO-1 and inhibiting MAPK/NF-κB/NLRP3 pathways. Biomed Pharmacother 2024; 170: 116003.
Liao P, Li Y, Li M, Chen X, Yuan D, Tang M, et al. Baicalin alleviates deoxynivalenol-induced intestinal inflammation and oxidative stress damage by inhibiting NF-κB and increasing mTOR signaling pathways in piglets. Food Chem Toxicol. 2020; 140: 111326.
Tang M, Yuan D, Liao P. Berberine improves intestinal barrier function and reduces inflammation, immunosuppression, and oxidative stress by regulating the NF-κB/ MAPK signaling pathway in deoxynivalenol-challenged piglets. Environ Pollut. 2021; 289: 117865.
Prakash AV, Park IH, Park JW, Bae JP, Lee G, Kang T. Nlrp3 inflammasome as therapeutic targets in inflammatory diseases. Biomol Ther. 2023; 31: 395 - 401.
Upadhyay R, Mohan Rao LJ. An outlook on chlorogenic acids-occurrence, chemistry, technology, and biological activities. Crit Rev Food Sci Nutr. 2013; 53 (9): 968-84.
Khan S, Baboota S, Ali J, Narang RS, Narang JK. Chlorogenic acid stabilized nanostructured lipid carriers (NLC) of atorvastatin: formulation, design and in vivo evaluation. Drug Dev Ind Pharm. 2016; 42(2): 209-20.
Zhu L, Zhou J, Lou L, Liu Y, Deng J. Chlorogenic acid induces apoptosis to inhibit inflammatory proliferation of il-6-induced fibroblast-like synoviocytes through modulating the activation of jak/stat and nf-kappa b signaling pathways. Exp Ther Med. 2016; 11(5): 2054-60.

GraphicalAbstract.jpg
FiguresS1.doc
Figure S1: Diagram illustrating the dual-signaling pattern of the initiation and activation of the NLRP3 inflammasome (Swanson et al., 2019, Nat Rev Immunol)

Download PDF

Version 1

posted

You are reading this latest preprint version

Chlorogenic acid alleviates IPEC-J2 pyroptosis induced by deoxynivalenol through inhibiting the activation of NF-κB/NLRP3/Capase-1 pathway

Status:

Version 1

Abstract

Background

Results

Conclusion

Figures

1 Introduction

2 Materials and Methods

2.1 Reagents and antibodies

2.2 Cell culture

2.3 CCK-8 and MTT

2.4 Lactate dehydrogenase (LDH) activity assay

2.5 ROS assay by dichlorofluorescin diacetate (DCFH-DA)

2.6 Lyso-Tracker Red fluorescent (LTR)

2.7 Scanning electron microscope (SEM)

2.8 Acridine orange/ethidium bromide (AO/EB) dual staining

2.9 Terminal deoxynucleotidyl transferase–mediated dUTP-biotin nick end labeling assay (TUNEL)

2.10 Quantitative real-time PCR (qRT-PCR)

2.11 Western blotting

2.12 Immunofluorescence

2.13 Statistical analysis

3 Results

3.1 DON induces pyroptosis

3.2 CGA alleviates injury to IPEC-J2 cells induced by DON

3.3 CGA relieves IPEC-J2 pyroptosis induced by DON

3.4 CGA inhibits DON-induced pyroptosis via a dual-signaling pathway

4 Discussion

4.1 CGA alleviates injury to IPEC-J2 cells induced by DON

4.2 DON induces IPEC-J2 cell pyroptosis by participating in the priming and activation signaling pathways

4.3 CGA inhibits DON-induced pyroptosis through the NF-κB/ROS/NRPR3 signaling pathway

5 Conclusion

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1