2.1 Bioinformatics analysis
We used online databases (circinteractome, starbase and circbank) to find potential miRNA of circPVT1 and the starbase databases was used to predict the target genes of miR-140-3p.
2.2 Clinical Specimens
39 pairs of BC clinical specimens and adjacent normal tumors were collected from the First Affiliated Hospital of Jiamusi University. None of them had undergone chemotherapy, radiotherapy or any anti-cancer treatment before surgery and all of the clinical specimens were immediately flash-frozen in liquid nitrogen during surgery until RNA extraction.
2.3 Cell culture and cell transfection
T24, UMUC3, EJ ,5637, J82, and SV-HUC-1 were obtained from the Cell Collection Committee of the Chinese Academy of Sciences (Shanghai, China). Cells were incubated by RPMI-1640 medium (Gibco, USA) with 10% FBS (Gibco, Australia) at 37℃. CircPVT1 sh-RNA and circPVT1 over-expression plasmids were synthesized by GenePharma (Shanghai, China). MiRNAs inhibitors were purchased from RiboBio (Guangzhou, China) and cell transfection was performed using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s protocol.
2.4 RNA isolation , RNase R treatment and Real-Time PCR
The total RNA was extracted from 39 pairs of BC clinical specimens and adjacent normal specimens or BC cells using TRIzol reagent (Invitrogen, CA, USA). 10 μg total RNA isolation was separated by 2 U/μg RNase R (Epicentre Technologies) 30 min at 37℃. Random primers and stem-loop primers were used to synthesize cDNA using the TaKaRa system (Takara, Dalian, China). RT-PCR primers were purchased from RiboBio. CircPVT1-Forward: ATCGGTGCCTCAGCGTTCGG, circPVT1-Re- verse: CTGTCCTCGCCGTCACACCG; miR-140-3p-Forward: GCGCGTACCACA- GGGTAGAA, miR-140-3p-Reverse: AGTGCAGGGTCCGAGGTATT; TRPS1-For- ward: GTATCCTGCATCGGGAGAAA,TRPS1-Reverse: AGCTTCTGGTAGAGG- CCACA; β-actin-Forward: CTTAGTTGCGTTACACCCTTTCTTG, β-actin-Reverse: CTGTCACCTTCACCGTTCCAGTTT; Real-time PCR was detected by the CFX96 Tm Real-Time System (Bio-Rad, USA). The calculation method of relative expression was using the comparative Ct( 2−ΔΔCt) method.
2.5 CCK-8 assay
BC cells proliferation were determined by CCK-8 assay (Dojindo, Japan) following the manufacturer’s instructions, a density of 1×104 T24 and EJ cells were plated into 96-well plates. After 24h, 10 μL of CCK-8 solution was combined and incubated without light for 2h at 37℃. The absorbance was measured at a wavelength of 450 nm using the BioTek (Winooski,USA) microplate spectrophotometer.
2.6 Wound healing assay
1×104 cells/well T24 cells or EJ cells was seeded into 6-well plates. When the cells reached 90% confluency, the tip of a 200 μL pipette was used to scratch the cell monolayer and then fresh serous medium was used to wash the plates three times. After 24 h, the wound width was calculated using Image J software.
2.7 Transwell assay
1×104 cells/well T24 or EJ cells were seeded on the upper chambers with 2% serum medium and medium containing 20% serum medium were added to the lower chambers. Then, the cells were incubated at 37℃ for 24h. The migration cells number were counted to calculate the average number of migrated cells per plate.
2.8 Dual-luciferase reporter assay
Cells were cotransfected with circPVT1-miR-140-3p and TRPS1-miR-140-3p into the luciferase gene(wild-type or mutant-type), the specific operation was carried out according to the manufacturer’s protocol. After 48h, luciferase activities were calculated for each well using the Dual Luciferase Reporter Assay System (Promega).
2.9 RNA-binding protein immunoprecipitation (RIP)
RIP assay (Millipore, Billerica, MA) was carried out according to the manufacturer’s instructions. The RIP lysate was obtained and centrifuged at 14,000 rpm for 10 minutes. Add 100 µL of the supernatant to the RIP immunoprecipitation buffer containing the magnetic bead-antibody complex, then the RNA was purified and obtained from TRIzol. Finally, analysis of immunoprecipitated RNA by RT-PCR.
2.10 Tumor xenografts
5×106 cells/well T24 were stably transfected with sh‐circPVT1 plasmids or circPVT1 overexpression plasmids or negative control vector were subcutaneously injected into the upper back of nude mice. Tumor weight was detected every 7 days. The volume of tumors were calculated using the following formula: V = 0.5 × L × W2. one month later, all animals were scarified, and the tumor volume were recorded. The laboratory animals were approved by the medical laboratory animal ethics committee of Jiamusi University. Instructive notions with respect to caring for laboratory animals (which is released by the Ministry of Science and Technology of the People’s Republic of China in September 30th, 2006.) were followed for the welfare of the animals.
2.11 Western blot assay
Proteins were extracted from cells using RIPA with proteinase inhibitors (Sigma-Aldrich, USA) and the concentrations of proteins were measured using BCA Protein Assay kits (Thermo Scientifific, MA). After separation by 10% SDS/PAGE, proteins were blocked with 10% non-fat milk for 1 h and immunoblotted with the primary antiodies at 4 °C overnight. Proteins were incubated with secondary antibodies for 1 hr. After TBST washing 3 times and protein levels were measured using the chemiluminescence image system (Bio-Rad, USA).
2.12 Statistic analysis
All data were analyzed by SPSS 20.0, P < 0.05 indicated statistical significant findings. Data is represented as means ± standard, and the differences of the two groups’ data were analyzed by Student’s t-test; Pearson correlation analysis was used to evaluate the correlation among circPVT1, miR-140-3p and TRPS1.