Cell lines and cell culture
MDA-MB-231 was kindly provided by Ming-Yao Liu (East China Normal University, Shanghai, China). SKBR3 and BT549 were purchased from the cell bank of the Chinese Academy of Science (Shanghai, China). MDA-MB-231-LM2 was cultured in DMEM medium (Hyclone) supplemented with 10% FBS (Gbico). MDA-MB-231 was cultured in Leibovitz L-15 medium (Gibco) supplemented with 10% FBS. SKBR3 and BT549 were cultured in RPMI 1640 (Hyclone) medium supplemented with 10% FBS. All cell lines were incubated at 37 ℃ in a humidified atmosphere of 5% CO2 and 95% air except for MDA-MB-231 which were raised in a humidified atmosphere containing 100% air.
RNA extraction and quantitative real-time PCR
Total RNA of cancer cell line were extracted from Trizol reagents (Invitrogen#15596018) according to the manufacturer’s instructions. cDNA was obtained by AMV reverse transcription system (TAKARA#2621) followed the manufacturer’s protocol. Quantitative real-time PCR was performed with SYBR Green PCR master mix reagent (ABI#4472908) and specific primers for SMAD7-F/R (ATGCTGTGCCTTCCTCCGCTG/CCACGCACCAGTGTGACCGA) and ARHGAP5-AS1-F/R (GGCCCCTGATTCAGTACGTT/GCGTGAACAGGGGTCTTTTG). Data analysis of ARHGAP5-AS1 expression in breast cancer cell lines was normalized by internal control 28S RNA and evaluated using 2∆∆Ct method, while data analysis of breast cancer tissues was normalized by 18S RNA and presented by -∆Ct.
LncRNA in vitro Translation
This experiment was performed according to the manufacturer’s instructions (Promega#L1170). Briefly, 1 µg of circular plasmid pcDNA3.1(+)-ARHGAP5-AS1 and pcDNA3.1(+)-ARHGAP5-AS1-AS were used in the translation reaction. The tubes were incubated 1 h at 30 ℃. Then, 2 µL of reaction liquid was added into 15 µL SDS Loading Buffer and boiled 3 times at 105 ℃ on incubator. Streptavidin-HRP (CST#3999) was utilized to detect products of translation.
Immunofluorescence staining
F-actin staining was performed according to the manufacturer’s instructions (Invitrogen#R415). Briefly, 1.5 × 105 cells transfected with si-NC/si-ARHGAP5-AS1 or pcDNA3.1(+)-VEC/pcDNA3.1(+)-ARHGAP50AS1 for 48 h were seeded onto coverslips in 24-well culture plate. A total volume of 200 µL containing 4 µL Rhodamine Phalloidin was used per well and incubated 30 min at room temperature. As for SMAD7 staining, the FITC conjugated antibody (Santa Cruz#sc-365846 FITC) was used at the dilution rate of 1:50 in 1% BSA and incubated overnight. Immunofluorescence pictures were taken by Nikon A1R confocal microscope (Nikon, Kanagawa, Japan).
Transwell migration assay
Cell migration ability was determined by transwell chambers (Corning#3422). The experimental procedure was described elsewhere [18]. Briefly, 2 × 104 cells transfected with si-NC/si-ARHGAP5-AS1 or pcDNA3.1(+)-VEC/pcDNA3.1(+)-ARHGAP50AS1 for 48 h were seeded into transwell chambers. 18 h later, migrated cells were staining by crystal violet. Pictures were taken by Nikon Eclipse Ti microscope (Nikon, Kanagawa, Japan).
RNA Fluorescent in situ hybridization
This experiment was performed with Fluorescent In Situ Hybridization Kit (Ribo#R11060.1) according to the manufacturer’s protocol. Briefly, 1.5 × 105 MDA-MB-231 cells or LM2 cells was seeded onto cover slides in 24-well culture plate. LncRNA ARHGAP5-AS1 was detected by specific probe with Cy3 labeling. Fluorescence pictures were taken by Nikon Eclipse Ti microscope (Nikon, Kanagawa, Japan).
Protein microarray screening
Sense and antisense lncRNA were transcripted in vitro with Cy5 labeling. Synthesized lncRNA were incubated with HuProt™ microarray (CDI Laboratories, Inc.) which contained more than 20000 full length human proteins with GST tag. This procedure was completed by Wayen biotechnologies (Shanghai), Inc. according to the manufacturer’s instructions. In brief, proteome microarrays were blocked with blocking buffer for 1 h at room temperature before incubation of transcripted lncRNA in blocking buffer with microarray at room temperature for 1 h. TBST followed by MilliQ water were used to wash the microarrays three times for 5 min. Dried slides were scanned using GenePix 4000B. Images were analyzed using GenePix Pro 6.0.
RNA pull down assays
In vitro transcription of antisense or sense ARHGAP5-AS1 was achieved by T7 RNA Polymerase (Roche#10881767001) according to the manufacturer’s instructions. Meanwhile, 2 µL of Biotin RNA Labeling Mix (Roche#11685597910) was added into the transcription reaction. Cell lysates were prepared by sonication in BufferA [150 mM KCl, 25 mM Tris pH7.4, 5 mM EDTA, 0.5 mM DTT, 0.5% NP40 supplemented with 1mM PMSF (Bytotime#ST506) and Cocktail (Millipore#539134)]. 15 µg transcripted RNA was added into lysates of 1×107 cells and incubated at 4 ℃ for 2 h in a rotary shaker. Streptavidin Magnetic Beads (NEB#S1420) was utilized to enrich RNA-protein complex before washing five times in BufferA and elution in SDS Loading buffer. Eluted proteins were separated by SDS-PAGE for western blot.
RNA Immunoprecipitation (RIP) assays
RIP assays were performed by utilizing the Millipore Magna RIP Kit (#17–700) according to the manufacturer’s protocol. Bound RNA was extracted by Trizol reagents and subjected to real-time PCR using specific primers.
Dual luciferase reporter assays
4×SBE was synthesized and cloned into pGL4.27 vector. 293T cells were cultured in 24-well tissue culture plates 24 h before transfection. Each three wells were transfected with pGL4.27-4×SBE/EV, pcDNA3.1(+)-ARHGAP5-AS1/EV and Renilla. 5 ng/mL TGFβ1 was added into each well 48 h after transfection. After 6 h stimulation, 293T cells was lysed by Passive Lysis Buffer. Luciferase activity were detected according to manufacturer’s protocol (Promega#E1910).
Western blot
This experimental procedure was described elsewhere [18]. Antibodies used in this article: SMAD7 (Sigma-Aldrich#SAB1404041-100UG), β-actin (MBL#PM053-7), LARP1 (ABCAM#AB86359), GAPDH (Santa Cruz#SC-32233), FLAG (Sigma-Aldrich#F1804), SMAD7-B8-FITC (Santa Cruz#SC365846FITC), p-SMAD-2/3 (CST#9510), SAMD2/3 (CST#8685), TGF-βR1(Sigma-Aldrich#SAB4502958-100UG), LaminB (Santa Cruz#SC6216), HIS (Beyotime#AH367).
Statistical analyses
All experiments were repeated at least three times or otherwise mentioned. The p-values for comparison between two groups were obtained by Student’s t-test (two-tailed). All values were presented as Mean ± STD and the p-value < 0.05 was considered to be statistically significant.