Preparation of human iPS-derived cardiomyocytes (hiPSCMs) and simulated I/R model. Human induced pluripotent stem cells (hiPSCs) were purchased from Phenocell (PCi-CAU); ~0.5 × 105 viable cells were provided in cryovials. hiPSCs were initially grown to 80% confluence in mTeSR™ plus medium on Matrigel® matrix to allow attachment of cell aggregates and maintained in a humidified 95% air, 5% CO2 atmosphere at 37°C. When the cells reached passage 20, the reprogramming procedure was started using our standardized protocol. Briefly, the culture medium was removed and replaced with RPMI-1640 containing B27 supplement minus insulin (basal differentiation supplement) and 4 µM CHIR99021 (day 0). On day 3, the medium was changed to basal differentiation supplement containing 3 µM of IWR-1. On day 5, the medium was refreshed with basal differentiation supplement. The medium was replaced on day 8 with fresh RPMI 1640 containing B27 supplement minus insulin. On day 11, the medium was changed to glucose-free RPMI 1640 containing B27 supplement minus insulin. On day 14, the medium was reverted to RPMI 1640 containing B27 supplement minus insulin. Differentiation cultures were maintained in a 95% air, 5% CO2 atmosphere at 37ºC. During differentiation, the medium was replaced every 3 days. Beating clusters were observed after 20 days. hiPSCMs were allowed to recover for 12 days in iCell Maintenance Medium (Cellular Dynamics International) before experiments. Before assays, standardized RT-qPCR gene expression profiles were determined for hiPSCs and derived hiPSCMs (Figure S1). OCT4 and NANOG were used as hiPSC-specific markers and cTnT and NKX 2–5 as hiPSCM-specific markers.
The I/R model was adapted with modifications from the experimental design of Sebastião et al. 25. In brief, ischemia was mimicked by replacing iCell medium with ischemia-mimetic solution (140 mM NaCl,12 mM KCl, 1.2 mM MgCl2, 20 mM HEPES,1.8 mM CaCl2, 20 mM sodium lactate, pH 6.22) and placing the hiPSCMs cultures in a hypoxia chamber (STEMCELL Technologies; 27310) at 37°C in a nitrogen-enriched atmosphere to achieve a 1% O2 concentration. After 45 min of simulated ischemia, reperfusion was mimicked by reoxygenation in control culture conditions (iCell medium at 21% O2), which were maintained for a recovery period of 24 h. Control cultures were maintained throughout experiments in iCell medium at 21% O2. When indicated, 50 µM AEOL or 30 nM DWORF were added at the onset of reoxygenation. At the end of the 24 h reoxygenation–recovery period, cells were processed for subsequent analysis. For succinate treatment, hiPSCMs were incubated in assay buffer (132 mN NaCl, 10 mM HEPES, 4.2 mM KCl, 1 mM MgCl2, 1.8 mM CaCl2, 2.5 µM 2-deoxyglucose, 1.14 sodium pyruvate, pH 7.4) and treated with the indicated agents in the presence or absence of 5 mM dimethyl succinate or 4 µM oligomycin for 2 h.
Animal care and ethics. Male C57Bl/6J mice (25–30 g) were purchased from the ENVIGO Laboratory. Colonies of Nfe2l2tm1Ywk (Nrf2) knockout mice ( Nrf2-KO) and Nrf2-WT littermates were from the Jackson Laboratory. Nrf2 gene knockout was confirmed by genotyping with the Jackson Laboratory-recommended protocol and primers: Nrf2 common_forward (5´ -GCCTGAGAGCTGTAGGCCC-3´), Nrf2 WT_reverse (5´-GGAATGGAAAATAGCTCCTGCC-3´), and Nrf2 Mut_reverse (5´-GACAGTATCGGCCTCAGGAA-3´). Animals were housed in a specific pathogen-free environment at 23 ± 2°C and 50 ± 5% relative humidity and with a 12 h light–dark cycle. Mice had free access to food and water. All animal experiments were approved by the Ethics Review committee for animal use at the University of Murcia (approval No. A13220701). Animals were adapted to the environment for 7 days before experimentation.
In vivo myocardial I/R model and experimental design. Mice were anesthetized and ventilated via tracheal intubation with a Harvard rodent respirator. The left anterior descending coronary artery was ligated with a 6 − 0 silk suture slip knot positioned approximately 2 mm below the edge of the left atrial appendage. mI/R injury was initiated by tightening the slip knot to induce ischemia, followed after 45 min by release of the knot to produce myocardial reperfusion and recovery for 30 min, 24 h, 28 days (4 weeks), or 56 days (8 weeks). The animals were randomly assigned to receive AEOL (25 mg/kg in physiological saline solution (0.9% NaCl)) or vehicle (saline solution only), administered via subcutaneous injection after reperfusion onset. The AEOL dose was based on a published analysis of in vivo efficacy in mice 26. The study comprised two distinct phases. The initial phase aimed to examine the protective effects of AEOL against acute-phase mI/R injury (Figure S2, Experiment 1). Mice subjected to mI/R received a single dose of AEOL or vehicle at 15 min after reperfusion onset and were then allowed to recover for either 30 min or 24 h (Figure S2; Experiment 1). The second part of the study explored the long-term benefits of AEOL on adverse cardiac remodeling. A separate cohort of mice underwent mI/R and received daily repeat injections of AEOL or vehicle for 5 days, starting at 5 min, 15 min, or 3 days after reperfusion onset (Figure S2; Experiment 2). These mice were allowed to recover for either 4 or 8 weeks When indicated, mice received intraperitoneal injections of 30 nM DWORF coincident with AEOL treatment.
Measurement of mitochondrial ROS in vitro and in vivo. To measure mitochondrial ROS production in hiPSCMs, 3x106 cells suspended in DPBS were incubated for 20 min at 25ºC with the fluorescent probe MitoSox (Invitrogen) at 5 µM. The cells were then washed and centrifuged (480 xg, 10 min), and changes in fluorescence intensity were measured at λex = 510 nm and λem = 580 nm in a Clariostar microplate reader (BMG Labtech). Mitochondrial ROS production was plotted as the relative increase in fluorescence.
Mitochondrial ROS production in the hearts of mice subjected to mI/R injury was estimated from the conversion of the ratiometric probe MitoB to MitoP 27. Briefly, 25 nmol MitoB (Cayman Chemical; 17116) in 100 µL DPBS was administered via tail vein injection 4 h before initiating the mI/R protocol (with or without AEOL injection 15 min after reperfusion onset). After reperfusion and recovery for 30 min or 24 h, hearts were removed. The infarct border zone was processed and flash frozen in liquid nitrogen. Heart tissue samples were homogenized, spiked with deuterated internal standards [d15-MitoB (Cayman Chemical; 17470) and d15-MitoP (Cayman Chemical; 19296)], and MitoB and its product MitoP were determined by liquid chromatography and tandem mass spectrometry. The MitoP/MitoB ratio was plotted as the relative increase relative to sham operated mice.
Measurement of oxidative DNA damage. DNA samples were prepared from the infarct border zone 30 min after mI/R, incubated at 95ºC for 5 min, and rapidly chilled on ice to prevent re-annealing of single-stranded DNA. The DNA was then digested with 5 units of nuclease P1 in 20 mM sodium acetate, pH 5.2 for 2 h at 37ºC. Next, samples were resuspended in 100 mM Tris buffer, pH 7.5 and treated with 5 units of alkaline phosphatase for 1 h at 37ºC. The reaction mixtures were centrifuged for 5 min at 6,000 ×g, and the supernatants were analyzed by competitive ELISA for 8-hydroxy-2’-deoxy guanosine (8-OHdG) (OxiSelect™ Oxidative DNA Damage ELISA Kit; Cell Biolabs STA-320-T). Absorbance was read at 450 nm in a Clariostar microplate reader (BMG Labtech), and the fold change in 8-OHdG was plotted relative to sham-operated mice.
Mitochondrial function and cell viability. hiPSCMs were subjected to simulated I/R with or without AEOL treatment at the onset of reoxygenation. At the end of the 24-h reoxygenation period, the conditioned medium was collected for lactate assay (Abcam; ab653331), and the cells were harvested for the determination of ATP content with the ATP Luminometric Assay kit (Beyotime Institute of Biotechnology). Total protein was determined by the bicinchoninic acid (BCA) method 28. To measure mitochondrial membrane potential (Δψm), hiPSCMs were loaded with TMRE (500 nm) (Abcam; ab113852) for 30 min at 37°C. Cells were then washed twice with warm DPBS containing 0.2% bovine serum albumin (BSA) (w/v), and fluorescence intensity was detected in a plate reader with excitation/emission at 549/575 nm. MPTP opening was assayed with the Mitochondrial Transition Pore Assay Kit (Life Technology). Cell viability was measured with the Cell Counting Kit-8 (Enzo; ALX-850-039). Measurements and analysis were carried out in a Clariostar microplate reader (BMG Labtech).
TUNEL assay of mI/R-induced apoptotic cell death. In mice at 24 h post-mI/R, hearts were arrested in diastole by intravenous injection of a 0.2 mL bolus of 30% (w/v) KCl (Merck). The hearts were excised and rinsed with ice-cold DPBS before removal of the right ventricle and atria. Mid-papillary slices of the left ventricle (n = 7 mice per treatment group) were fixed in 4% (w/v) formaldehyde for up to 24 h before paraffin embedding. The slices were stained by terminal deoxynucleotidyl transferase dUTP nick end labeling (DeadEnd colorimetric TUNEL system, Promega Corporation). Apoptotic cells were identified by dark-brown precipitation in cardiomyocyte nuclei, visualized in high-power visual fields (400X) with an Axioscope Axio A10 brightfield microscope (Carl Zeiss) fitted with a high-resolution color digital camera (AxioCam 506 color). Representative images were obtained with Zeiss Zen, version 3.0 (Cals Zeiss).
Assessment of myocardial infarct size. Mice at 8 weeks post-mI/R were given a KCl bolus as above to arrest the heart in diastole. After sacrifice, hearts were excised, rinsed in ice-cold DPBS, and frozen by immersion in liquid nitrogen for 10 min. Frozen mid-papillary slices (1–3 mm) of the LV of seven mice from each treatment group were immersed in 1% 2,3,5-triphenyl-tetrazolium chloride (TTC; Merck) in DPBS at 37°C for 15 min to stain the non-infarcted tissue. The slices were photographed, and the perimeters of the left ventricle and the infarcted area were traced manually on digital images and measured with ImageJ software (National Institutes of Health). The size of the infarcted area was calculated as the percentage of the left ventricle and expressed as the fold difference from control.
Echocardiography analysis of heart function. Mice were examined before surgery (baseline) and at 1, 4, and 8 weeks post-mI/R by transthoracic echocardiography under anesthesia (1-1.5% isoflurane) by a blinded trained investigator (MJFP). Images were acquired with a Vevo 3100 high-frequency ultrasound imaging system (VISUALSONICS, Inc, Toronto, Canada) fitted with a 30-MHz central frequency transducer and connected to an integrated rail system III. All echocardiographic parameters were measured according to recommendations of the ESC Working Group on Myocardial Function in Adult Rodents 29. LV end-diastolic and end-systolic dimensions were measured by parasternal short-axis M-mode echocardiography, and FS was calculated using the ultrasound machine program; LV internal diameters at end diastole (LVIDd) and end systole (LVIDs) and EF were calculated in 2D mode from the right parasternal four-chamber long-axis view, using the modified Simpson method. Pulsed Doppler parameters of mitral inflow (early peak diastolic velocity (E), late peak diastolic velocity (A), and the E/A ratio) were measured in apical four-chamber view. Pulsed Doppler tissue parameters measured at the mitral septal annulus were peak systolic velocity (S’), early peak diastolic velocity (E’), and late peak diastolic velocity (A’), and the E/E’ ratio was calculated. Isovolumic relaxation time (IVRT) was measured from synchronous left ventricular outflow tract flow and mitral flow and used to calculate the E/IVRT ratio.
Protein sample preparation. Fresh LV tissue (~ 30 mg) from the infarct border zone of mice 24 h after mI/R or hiPSCMs (~ 8x106 cells) were washed in cold DPBS and processed for the isolation of subcellular protein fractions (see Supplementary Material) or gently homogenized in RIPA buffer (Thermo Fisher) supplemented with 100-fold diluted protease and phosphatase inhibitors to obtain the total protein fraction. Homogenates were centrifuged at 20,000 xg at 4ºC for 20 min, protein concentration in the supernatants was measured by the BCA method 28, and samples were aliquoted and stored at -80ºC.
Western blotting. Proteins (35 µg) were denatured, separated by SDS-PAGE, and transferred to a polyvinylidene difluoride (PVDF) membrane (Merck Millipore, USA). Non-specific sites were blocked by incubating membranes with 5% (w/v) BSA in TBST (137 mM NaCl, 20 mM Tris, and 0.1% (v/v) Tween-20, pH 7.6), followed by overnight incubation at 4ºC with primary antibodies in blocking buffer. Membranes were then washed 5 times for 10 min each with TBST and incubated for 1 h at room temperature (RT) with the appropriate secondary antibody in blocking buffer. After a further 5 more 10 min washes in TBST, immunoreactive bands were detected by enhanced chemiluminescence (Amersham ECLTM Primer Western Blotting Detection Reagent
(GE Healthcare) (RPN2232), using a ChemiDoc XRS + system with Image Lab software from Bio-Rad Laboratories. Band density was quantified with Gel-Pro Analyzer 3.1 software (Sigma). Molecular weight was determined by comparison with prestained protein markers (Precision Plus Protein™ Dual Color Standards, Bio-Rad 1610374). Equal loading was monitored with antibodies to GAPDH (for cytosolic fractions) or H3 (nuclear fractions). Antibodies and their dilutions, sources, and references are summarized in Table 1.
Table 1
Antibodies and dilutions.
| Protein | Provider | Code | Dilution |
Antibodies | 1º | Bax | Cell Signaling | #2772 | 1:4000 |
Bcl2 | Cell Signaling | #3498 | 1:2000 |
NRF2 (D1Z9C) | Cell Signaling | #12721 | 1:1000 |
Phopho- PLN | Badrilla | A010-12AP | 1:3000 |
PLN | Badrilla | A010-14 | 1:10000 |
DWORF | Mybiosource | MBS5400388 | 1:5000 |
SERCA 2a | Cell Signaling | #4388 | 1:1000 |
GAPDH | SIGMA | G9545-100UL | 1:5000 |
Keap1 | Cell Signaling | #8047 | 1:5000 (cells) |
P62 | Cell Signaling | #5114 | 1:5000 |
LC3A/B | Cell Signaling | #4108 | 1:2000 |
HO-1 | Cell Signaling | #43966 | 1:2000 |
| Histone H3 | Cell Signaling | #9715 | 1:1000 |
2º | ECL Mouse IgG, HRP-linked whole Ab | Promega | W402B | 1:10000 |
ECL Rabbit IgG, HRP-linked whole Ab | Promega | W401B | 1:5000 |
In vitro knockdown. hiPSCMs were transfected with specific siRNAs targeting NRF2 (Accell Human NFE2L2 siRNA, DHARMACON) or DWORF (SIRGT66230WQ-2OMe, CREATIVE BIOLABS) using Lipofectamine™ MessengerMAX™ Transfection reagent (Thermo Fisher). Cells were seeded 2 days before transfection in 6-well plates with 2 mL STEMdiff Cardiomyocyte Support Medium (STEMCELL Technologies) at 60% confluence. Stock transfection mixes were prepared according to the manufacturer’s instructions. In brief, 9 µL Lipofectamine reagent was diluted in 141 µL Opti-MEM I Medium (Invitrogen) and incubated for 5 min at RT. In another tube, siRNAs or a scrambled control RNA oligonucleotide were diluted with Opti-MEM to a final concentration of 25 nM. The mixes were then combined and incubated for 30 min at RT to allow the formation of RNA–lipid complexes. For transfections, the STEMdiff Cardiomyocyte Support Medium was removed and replaced with 1.75 mL fresh medium and 250 µL of the appropriate transfection mix. The cells were incubated at 37°C for 48 h, after which they were washed twice with DPBS at 37°C before ischemia. Transfection efficiency was determined and is shown in Figure S3.
RNA extraction and quantitative RT-PCR. Fresh samples of LV infarct border zone (~ 30 mg) from mice at the indicated time after mI/R or hiPSCMs (2 x106 cells) were washed with cold DPBS. Cells were pelleted by centrifugation at 480 ×g for 10 min at 4°C, whereas tissue samples were placed in a pre-chilled glass Petri dish in an ice bath and chopped with sharp scissors. RNA was extracted with the RNeasy Mini Kit (QIAGEN), and cDNA was prepared with the iScript cDNA Synthesis Kit (Bio-Rad). Quantitative real time polymerase chain reaction (RT-qPCR) was performed with the TB Green Premix Ex Taq II (Tli RNase H Plus) Master Mix (Takara Bio). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the housekeeping control gene. Primers were obtained from Merck, and sequences are listed in Table 2.
Table 2
Primer sequences used for quantitative real-time PCR analysis
| Primer | Forward (5'-3') | Reverse (5'-3') |
Human | GAPDH | TCAACGACCACTTTGTCAAGCTCA | GCTGGTGGTCCAGGGGTCTTACT |
NANOG | CATGAGTGTGGATCCAGCTTG | CCTGAATAAGCAGATCCATGG |
NKX 2–5 | CTACGGTTATAACGCCTACCC | CGAAGTTCACGAAGTTGTTGTT |
NRF2 | GCGCAGACATTCCCGTTTGT | GCTCTCGATGTGACCGGGAA |
OCT4 | TCTTTCCACCAGGCCCCCGGCTC | TGCGGGCGGACATGGGGAGATCC |
cTnT | GGCAGCGGAAGAGGATGCTGAA | GAGGCACCAAGTTGGGCATGAACGA |
DWORF | TTCTTCTCCTGGTTGGATGG | TCTTCTAAATGGTGTCAGATTGAAGT |
Mouse | Nrf2 | TGCTCGGACTAGCCATTGCC | GTCTTGCCTCCAAAGGATGTCA |
Co-immunoprecipitation. hiPSCM extracts (8 × 106 cells/extract) were collected and incubated overnight with an antibody to PLN (Badrilla, A010-14, 1:100), SERCA (Cell Signaling, 4388, 1:100) or DWORF (Mybiosource, MBS5400388, 1:500) at 4°C with gentle shaking. To the incubation was added 20 µL of protein A–Sepharose slurry, followed by further incubation for 4 h at 4°C with gentle shaking. The beads were then washed 3 times with immunoprecipitation (IP) buffer (20 mM HEPES pH 7.4, 0.5 mM EDTA, 150 mM NaCl, and 0.1% Triton X-100) to remove non-specifically bound proteins. In each wash, the beads were mixed gently with IP buffer and centrifuged for 10 min at 480 xg and 4°C, and the supernatant was discarded. To elute antigen–antibody complexes, the beads were resuspended in 25 µL SDS gel-loading buffer and heated at 95°C for 4 min. After this, samples were separated by SDS-PAGE at 30 mA constant current for 2 h. Immunocomplexes were analyzed by western blotting with primary antibodies to SERCA2a (Cell Signaling, 4388, 1:1000), PLN (Badrilla, A010-14, 1:10000), or DWORF (Mybiosource, MBS5400388, 1:5000). IgG was used as a control.
Isolation of microsomal fractions and determination of SERCA2a activity. Microsomal fractions enriched in sarcoplasmic reticulum (SR) vesicles were isolated as described in 30, with modifications. LV tissue samples (∼80 mg wet weight) obtained from the infarct border zone of mice 24 h after mI/R were homogenized in liquid nitrogen using a pestle and mortar in 10 mM NaCO3 at 1:20 dilution, supplemented with protease inhibitors and phosphatase inhibitors. The homogenate was incubated on ice for 20 min and centrifuged at 5,900 xg for 10 min at 4°C, and the supernatant was collected and centrifuged at 51,000 xg for 60 min at 4ºC. The resulting supernatant (cytosolic fraction) was discarded, and the pellet was resuspended in 0.6 mM KCl and resedimented at 100,000 xg for 40 min to obtain the microsomal fraction (SR vesicles). Protein concentration was measured by the BCA method 28, and samples were aliquoted and stored at − 80 ℃ until use.
SERCA2a activity was assayed in 96-well microplates using an enzyme-coupled, NADH-linked ATPase assay 31 with modifications. Each well contained assay mix (50 mM MOPS pH 7.0, 100 mM KCl, 5 mM MgCl2, 1 mM EGTA, 0.2 mM NADH, 1 mM phosphoenol pyruvate, 10 IU/mL pyruvate kinase, 10 IU/mL lactate dehydrogenase, 1 µM A23187, 1 mM CaCl2 (free Ca2+, 10 µM), and 0.02 mg SR protein/mL). The assay was started by adding ATP to a final concentration of 5 mM (200 µL total assay volume/well), and absorbance was measured at 340 nm in a Clariostar microplate reader (BMG Labtech). As a control, SERCA pump activity was blocked with 100 nM thapsigargin 32. Samples were tested in triplicate.
Measurement of circulating sST2. Plasma samples isolated from mice 24 h after mI/R were assayed for sST2 levels, as previously described 33 using an ELISA kit (Quantikine ELISA Mouse ST2/IL33R (MST200); R&D Systems, USA). Measurement at 24 h post-mI/R was based on a previous study showing an increase in circulating sST2 in acute-phase injury 33. Reactions were terminated by addition of a stop solution, and absorbance was determined at 450 nm in a Clariostar microplate reader (BMG Labtech). Intra- and inter-assay precision in term of coefficient of variation were less than 10%.
Statistical analysis. Data are reported as mean ± SEM. Statistical differences were evaluated by fitting linear models, with interactions determined by one-way ANOVA followed by post hoc testing with the Bonferroni correction. Differences were considered significant at p < 0.05.