2.1 Pre-miRNA gene amplification
In this investigation, miR-21 was employed as a representative miRNA model. Human blood samples for DNA extraction were not collected directly from participants. Instead, samples were obtained from ZaverZistAzma Company (ZaverZistAzma #28–754). The use of these samples adhered to ethical guidelines and regulations and was approved by the Ethics Committee of Kerman Neuroscience Research Center, Kerman, Iran (EC/KNRC/86 − 31). DNA extraction was performed using the H-DNA extraction kit (ZaverZistAzma #5412) following the manufacturer's instructions. To amplify the pre-miRNA-21 gene, a mixture containing 2 µg of template DNA extracted from blood, 0.5 µL each of the forward and reverse primers (Table 1), 7 µL of water, and 10 µL of PCR master mix was prepared. The PCR protocol encompassed an initial denaturation step at 95°C for 10 minutes, followed by 38 cycles involving denaturation at 95°C for 20 seconds, annealing at 61°C for 20 seconds, and DNA extension at 72°C for 40 seconds. The resulting PCR products were then visualized by loading them onto a 1% agarose gel.
Table 1
Primers used in the present study
Primer name | Sequence (5'-3') | Reason/Product lenght |
F-miR21 primer | ATAGAAGCGGCCGCGGGTTCGATCTTAACAGGCC | To amplify miRNA-21 precursor of genomic DNA/ 430bP |
R-miR21 primer | GCATTCACTATCAAAACCCACAATGCAGCT |
F-miR21-sticky primer | CACCTATAGAAGCGGC | To amplify Forward strand of precursor/434bp |
R-miR21-sticky primer | AAACTGCATTCACTATC | To amplify reverse strand of precursor/434bp |
Oligonucleotide-1 | GGCCGCCACCGGGTCTTCGAGAAGACCTGTTTTG | To confirm presence of Oligo1and Oligo2 in plasmid/190bp |
RVpJEBB | GTCGAGGACCTGGAGGG |
FVpJEBB | CTGCCCGACAACCACTACC | To confirm presence of Oligo1and Oligo2 in plasmid/100bp |
Oligonucleotide-2 | TCGACAAAACAGGTCTTCTCGAAGACCCGGTGGC |
miR-21 RT primer | CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTTGA | To cDNA synthesizes of miR-21 |
U48 RT primer | CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTTGG | To cDNA synthesizes of U48 |
miR21F primer | GGCGTAGCTTATCAGACTGATG | To conduct qPCR for relative expression of miR-21/ 72bp |
RUni | CCAGTGAGCAGAGTGACG |
U48F primer | TGATGACCCCAGGTAACTCTG | To conduct qPCR for relative expression of U48 as references gene/ 72bp |
RUni | CCAGTGAGCAGAGTGACG |
2.2 Generation of pre-miR-21 with suitable sticky ends
To generate suitable sticky ends in the pre-miRNA segment, a primer set was utilized (Table 1). Two distinct PCR reactions were conducted, with each one employing either the forward or reverse primer, respectively. In these reactions, the product obtained from the prior PCR reaction served as the template DNA. The PCR protocol for both reactions included an initial denaturation step at 95°C for 5 minutes, followed by 60 cycles comprising denaturation at 95°C for 55 seconds, annealing at 58°C for 20 seconds, and DNA extension at 72°C for 40 seconds. The initial PCR reaction yielded a single forward strand, complementary to the sense strand of the miR-21 precursor gene, with an overhanging end that matched one of the vector's sticky ends. The subsequent PCR reaction produced a single reverse strand that complements the anti-sense strand of the miRNA-21 precursor gene and possesses a complementary overhang corresponding to another sticky end of the vector. To facilitate the annealing of the two synthesized forward and reverse strands, a mixture containing 3 µL of the forward strand, 3 µL of the reverse strand, 2 µL of annealing buffer, 4 µL of NaCl (0.5 M), and 8 µL of water was prepared. This mixture underwent annealing, starting with heating at 95°C for 5 minutes and gradually cooling to 25°C in the thermocycler. This process yielded the pre-microRNA gene with appropriate sticky ends (specifically BbsI restriction sites, CACC, and AAAC).
2.3 Construction of a pre-microRNA expressing vector with BbsI recognition sites and GTTT and GGTG restriction sites
In this study, the pJEBB vector was used for microRNA precursor gene cloning and microRNA overexpression (Fig. 1s). This vector has restriction sites for NotI and SalI enzymes. To create appropriate sticky ends in this vector that be proportional to the synthesized pre-microRNA gene sequence, the BbsI enzyme recognition site, and GTTT and GGTG sequences as restriction sites were located in the vector (Fig. 1b). In order to produce pJEBB vector containing BbsI recognition site and GTTT and GGTG restriction sites, two complementary oligonucleotides were used, which have two BbsI recognition sites, two different desired sequences (GTTT and GGTG) and the restriction sites of NotI and SalI enzymes at the overhanging 3'- and 5'- ends of their double-stranded hybrids, respectively (Fig. 1b). In order to annealing two oligonucleotides, 3 µL of oligonucleotide − 1, 3 µL of oligonucleotide − 2, 14 µL of annealing buffer (10 mM HCl, 10 mM DTT, 10 mM PEG, 100 mM NaCl and 10 mM MgCl2 were mixed and the mixture was annealed by heating at 95°C for 5 min, gradually cooled to 25°C in the thermo-cycler. This double-stranded product is called annealing product. In order to ligation, the annealing product to the pJEBB linear vector, which has sticky ends of restriction sites of NotI and SalI enzymes, 5 µL of linear vector, 2.5 µL of ligase buffer, 1 µL of T4 DNA ligase, 1 µL of annealing product, 0.5 µL of NaCl (0.5 M) and 10 µL of water were mixed and the mixture was incubated at 22°C for 1 h. Then, the transformation and screening steps were performed and to confirm the ligation process, the colony PCR technique was performed using primers in Table 1. The engineered expression vector was digested and linearized by the BbsI restriction enzyme. For this purpose, 5 µL of the circular vector, 5 µL of universal buffer and 0.2 µL of BbsI enzyme in a final volume of 50 µL were mixed and the mixture was incubated at 37°C for 45 min. To deactivate the enzyme, the reaction mixture was incubated at 65°C for 10 minutes.
2.4 Generation and transformation of the recombinant vector containing pre-miRNA gene
To perform the ligation of the synthesized pre-miRNA gene with the expression vector, a mixture was created by combining 7 µL of deionized water, 2 µL of pre-miRNA, 4 µL of the vector (at a concentration of 20–30 ng/µL), 2 µL of T4 DNA ligase buffer, and 0.2 µL of T4 DNA ligase enzyme. This mixture was then incubated at 22°C for 1 hour. For the subsequent transformation of the ligation product into DH5α cells, 7 µL of the ligation product was added to 100 µL of competent cells. The tube containing this mixture was placed on ice for 30 minutes after thorough mixing. The tube was then briefly subjected to a 42°C water bath for 60 seconds, followed by a return to ice for 2 minutes. Subsequently, 800 µL of LB media was introduced to the bacterial cells, which were then cultured in a shaking incubator at 37°C for 120 minutes. For the purpose of screening, all of the transformation products were spread onto LB agar plates supplemented with the ampicillin antibiotic. The PUC19 vector was employed as a positive control. Following an incubation period of 16–24 hours, numerous bacterial colonies were discernible on the culture medium.
2.5 Colony PCR technique
To validate the successful incorporation of the insert sequence (microRNA precursor) into the expression vector, colony PCR was conducted. A single colony was introduced into 10 µL of LB medium for inoculation. For the colony PCR procedure, a mixture containing 10 µL of PCR master mix, 0.5 µL of the primers specified in Table 1 (at a concentration of 30 µM), and 8 µL of water was prepared. From the resuspended inoculated bacteria, 2 µL was added to the PCR reaction. The PCR cycling conditions encompassed an initial denaturation step at 95°C for 10 minutes, followed by 38 cycles comprising denaturation at 95°C for 20 seconds, annealing at 58°C for 20 seconds, and DNA extension at 72°C for 20 seconds.
2.6 Bacterial culture and recombinant plasmid extraction
Upon validation through colony PCR, a single colony of genetically modified bacteria was cultured in 10 mL of LB medium supplemented with ampicillin (1 µg/mL). Following an incubation period of 16–24 hours, the bacterial cells were harvested by centrifugation, and the plasmids were extracted using the protocol provided by the GeneAll plasmid prep kit (Gene All Biotechnology, South Korea).
2.7 Cell culture and transfection
To assess the enhanced expression of microRNA, HEK293 cells were initially seeded in a 12-well cell culture plate at a density of 80×103 cells per well in 900 µL of DMEM high glucose culture medium supplemented with 1% penicillin-streptomycin antibiotic. Following a day of incubation, once the cell confluence reached 70–80%, the cells were subjected to transfection with the modified expression vector. The transfection procedure employed Turbofect (Invitrogen) in accordance with the manufacturer's guidelines, after which the plate was positioned within a 37°C incubation chamber for a 48-hour period. For transfection, a total of 3 µL of Turbofect was combined with 2 µg of the vector, and the final volume for the 12-well setup amounted to 1000 µL.
2.8 RNA extraction and cDNA synthesis
After allowing 24 hours of incubation post-transfection, the entire cellular RNA content was isolated. The extraction process for total RNA encompassed both the control and transfected cell samples, and this was achieved using the TRIzole reagent (ZaverZistAzma, Iran) as per the provided guidelines. To assess the quality of the extracted RNAs, spectrophotometric measurements were carried out. RNA samples were directly polyadenylated by poly A polymerase enzyme (NEB) then 3ug of RNA was reverse transcribed, using a cDNA synthesis kit (Applied Biosystems™) and specific primers designated listed in (Table 1), respectively. As an internal reference gene, RNA U48 was employed.
2.9 Real-time PCR
The quantification of microRNA-21 and the endogenous control (RNA U48) expression levels was conducted through real-time quantitative PCR. The primer sequences employed for this purpose were enumerated in Table 1. The reaction mixture consisted of 1 µL of cDNA samples, 1 µL of each specific primer, and 10 µL of SYBR Green PCR Master Mix (Amplicon), composing a total volume of 20 µL. The real-time PCR process was conducted using the Analytik Jena system. The PCR program encompassed an initial denaturation step at 95°C for 3 minutes, followed by 38 cycles. Each cycle involved denaturation at 95°C for 8 seconds, annealing at 61°C for 20 seconds, and DNA extension at 72°C for 15 seconds.
2.10 Statistical analysis
Statistical analysis was performed by SPSS statistics version 22. Data were represented as means ± Standard deviation and a P-value of < 0.05 was regarded as significant for the results.