2.1. Animals
Adult male Wistar rats, weighing 150–185g (or 5-6 weeks-old), obtained from the Experimental Animal Center of Shandong University, were used throughout the study. All rats were housed in a temperature and humidity-controlled environment under a 12 h light/dark cycle with free access to water and a standard rodent chow diet. In the handling and care of all animals, the International Guiding Principles for Animal Research as stipulated by the World Health Organization were followed.
2.2. Cells
RSC96 cells (CRL-2765) were obtained from the American Type Culture Collection (ATCC, cat no. CRL-2765) and were cultured in DMEM modified to contain 4 mM L-glutamine, 25 mM glucose, 1 mM sodium pyruvate, 1500 mg/L sodium bicarbonate, 10% FBS, 100 IU penicillin and 100μg/ml streptomycin at 37 °C in a humidified atmosphere of 5% CO2 and were passaged once every 3-4 days.
2.3. Virus packaging
Lipin1 overexpression and low expression of adenovirus and lentivirus were purchased from GeneChem, Shanghai, China. Adenovirus and lentivirus were carried eGFP. The Lipin1 overexpression and low expression of adenovirus (ADV-Lipin1/ ADV-Lipin1-RNAi) and corresponding adenovirus empty shell control (ADV-Lipin1-Con/ADV-Lipin1-RNAi-Con) were separately packaged. We also packaged Lipin1 overexpression and low expression of lentivirus (LV-Lipin1/ LV-Lipin1-RNAi), as well as the corresponding lentivirus empty shell control (LV-Lipin1-Con/LV-Lipin1-RNAi-Con). The titers of ADV-Lipin1, ADV-Lipin1-RNAi, ADV-Lipin1-Con, and ADV-Lipin1-RNAi-Con were 4.0×1010PFU/ml, 1.5×1010PFU/ml, 5.0×1010PFU/ml and 1.0×1010PFU/ml separately. The titers of LV-Lipin1, LV-Lipin1-RNAi, LV-Lipin1-Con, and LV-Lipin1-RNAi-Con were 1.0×109TU/ml, 7×108TU/ml, 2.0×109TU/ml and 1.0×109T U/ml separately. The transfection and expression efficiency of both high and low expression viruses were up to standard. The sequence of Lipin1-RNAi was caGCGAGTCTTCAGACACTTT. The sequence of Lipin1-RNAi-Con is TTCTCCGAACGTGTCACGT.
2.4. Animal model of DPN and virus intrathecal injection
Rats were first divided into negative control (NC) and diabetes mellitus (DM) group. All rats were adaptive feeding for one week in the rat room. After one week, DM was induced by intraperitoneal injection of streptozotocin (STZ, 55 mg/kg in 0.1 M citric acid buffer, pH 4.5). The rats with a fasting blood glucose levels above 16.7 mM 3-day after STZ injection were considered diabetic and were continued feeding for 8 weeks. Fasting blood glucose levels were measured 3-day, 1-week, 2-week, 4-week, 6-week, and 8-week after STZ injection to monitor the persistence of diabetes and paw mechanical withdrawal threshold (PMWT) were measured every 4 weeks to track the occurrence of peripheral neuropathy.
After the DPN rats were modeled, that is, 8 weeks after the diabetic rats were modeled, DM rats were divided into two groups, Lipin1 overexpression group (ADV-Lipin1) and Adenovirus empty shell group (ADV-Lipin1-Con). Meanwhile, NC rats were also divided into two groups, Lipin1 low expression group (ADV-Lipin1-RNAi) and Adenovirus empty shell group (ADV-Lipin1-RNAi-Con). And then intrathecal injection of ADV was carried out. Rats were anesthetized with sodium pentobarbital (40mg/kg) and removed the hair from the lumbar part of the rats to expose the skin, and 75% alcohol was used for disinfection. The rats were punctured into the subarachnoid space between the lumbar 3-4 or lumbar 4-5 with a special 25ul micro syringe(Feige, Nanjing, China) [18,19]. The tail flick reflex of the rats was used as a sign of the micro syringe entering the sheath. Then slowly injected four different ADV viruses, 20ul per rat, the injection time lasted no less than 5 minutes, stayed for 2 minutes, and then slowly pulled out the micro-injection needle. Disinfect the skin again, the rats were awakened in the incubator and moved into the ordinary feeding box. After 2 weeks of intrathecal injection, behavioral tests were performed, and rats were killed and sciatic nerves were taken.
2.5. Cell transfection
Cell culture and transfection. RSC96 cells plated at a density of 5.0 × 104cells/well in 6-well plates were allowed to adhere overnight and then transfected with four kinds of lentivirus according to the manufacturer’s instructions. According to the MOI value of RSC96 cells, the corresponding virus amount was added (Virus volume = (MOI×cell number) / virus titer). RSC 96 cells were incubated 12-16 hours at 37 °C in a CO2 incubator, 2ml conventional medium was added to replace the infection mixture. Cells were incubated for an additional 72 hours and the medium can be changed every 2 days to keep cell activity. 72 hours after infection, the following test was continued. Cells were aspirated and cultured in 25 mM or 100 mM glucose growth medium for 48 hours, respectively. Lipin1 low expression LV (LV-Lipin1-RNAi) and empty shell control (LV-Lipin1-RNAi-Con) group were treated with 25mM glucose, while Lipin1 overexpression LV (LV-Lipin1) and empty shell control (LV-Lipin1-Con) group were treated with 100mM glucose.
2.6. Measurement of paw mechanical withdrawal threshold (PMWT)
In a quiet environment, the rats were placed in a transparent plexiglass cover with a mesh pad made of metal wire at the bottom. After the rats adapted to the environment for 15 minutes until they were in a quiet state, the rats' PMWT was measured with the acupuncture pain test kit (vonfrey, Aesthesio, danmic Global, USA, measuring range of 0.008g-300g stimulation) [20]. The skin between the third and fourth toes of the rats was pressed vertically with nylon wires using different stimulating forces (the nylon wires were bent each time). When the rats had rapid retraction, hind foot lifting, quick swing, licking, and hissing after shaking their feet, the pressure was stopped, and the stimulation force was taken as the PMWT. Each rat was repeated 3 times. Each measurement included the left and right feet, each interval of 5 minutes. The average value of each measurement was taken as the PMWT.
2.7. Measurement motor nerve conduction velocity (MNCV) of sciatic nerve
Nerve conduction velocity was assessed using Functional Experiment System (BL-420s, Techman, China) as reported previously. Rats were anesthetized with isoflurane, then the left lower leg hair was removed, the skin was exposed. The skin of the sciatic node and the passing part of the sciatic nerve of the ankle joint were cut, and the sciatic nerve was carefully separated [21]. The stimulation electrode (S1) is located at the ischial notch, and the recording electrode (S2) is located at the ischial nerve passing through the ipsilateral ankle joint. The reference electrode (E) is located between S1 and S2, 1cm away from S2. Sciatic nerve was stimulated with single square wave pulses (1.2V in intensity, 1ms in width), and a biphasic compound action potential was recorded from S2. Repeat the measurement 5 times. MNCV (m/s) = sciatic nerve length (between S1 and S2) / nerve conduction time.
2.8. Electron microscopy (EM)
Electron microscopy (EM) analysis was performed to assess sciatic nerve and RSC96 cell ultrastructure. The tissues or cell sedimentation were then placed in 2.5% glutaraldehyde at 4 ◦ C for 24 h, followed by fixation with 1% osmium tetroxide for 2 h. After a series of graded ethanol dehydrations, the tissues or cell sedimentation were infiltrated with a mixture of one-half propylene oxide overnight and embedded in resin. The tissues or cell sedimentation were then cut into ultrathin sections (70 nm) and stained with 4% uranyl acetate for 20 min followed by 0.5% lead citrate for 5 min. Sciatic nerve and RSC96 cell ultrastructure were observed using EM (Philips Tecnai 20 U-Twin, Holland).
2.9. Quantitative real-time PCR (qPCR)
Total RNA was isolated and extracted from sciatic nerve and RSC96 cell samples using the Trizol Reagent (Invitrogen, USA). Total RNA (1μg) was reverse-transcribed into cDNA by using the PrimeScriptTM RT reagent Kit with a gDNA Eraser (TaKaRa, Japan) according to the manufacturer’s instructions. The reverse transcription reaction was amplified using a Bio-Rad CFX96 Detection System (Bio-Rad, USA). Quantitative Real time PCR was performed with use of the ChamQ SYBR qPCR Master Mix (TaKaRa, Japan) on the Bio-rad IQ5 Real Time PCR System (Bio-Rad, USA). Reaction conditions were: 95◦C for 2 min and 40 cycles of the amplification step (denaturation at 95◦C for 5 s, annealing at 55◦C for 5 s, and extension at 72◦C for 25 s). The following primers were used for qPCR: Lipin1-forward TATGACACGGCTTGTTCC; reverse GTGGCTGCCCTGTATTTC; β-actin-forward CCTAGACTTCGAGCAAGAGA; reverse GGAAGGAAGGCTGGAAGA; β-Actin served as a loading control in each sample, and targeted gene expression levels were evaluated using the 2−ΔΔCt method [22].
2.10. Western Blot
Sciatic nerves and RSC96 cells were lysed on ice in RIPA buffer with protease inhibitor cocktail and phosphatase inhibitor cocktail for 30 min and centrifuged at 1000 × g for 15min at 4◦C to extract total protein. The proteins were analyzed with a bicinchoninic acid (BCA) protein assay kit (Pierce Bio-technology, Inc., US). Equal amounts of protein (30μg) were subjected to SDS-PAGE analysis. The resolved proteins were transferred to PVDF membranes (Millipore, Bedford, MA). PVDF membranes were blocked in 5% nonfat milk for 1 h and then incubated overnight at 4 °C with the appropriate primary antibodies. The primary antibodies were as follows: rabbit anti-Lipin1 (1:250, Cell Signaling Technology, Beverly, MA), rabbit anti-P62 (1:500, Cell Signaling Technology, Beverly, MA), rabbit anti-LC3B (1:500, Cell Signaling Technology, Beverly, MA), rabbit anti-β-actin (1:5000, Cell Signaling Technology, Beverly, MA).After washing in TBS-T, blots were exposed to the appropriate secondary antibodies (1:5000, Abcam Co., UK) in TBS-T for 1 h at room temperature. Western Chemiluminescent HRP Substrate (Millipore Corporation, Billerica, MA01821, US) was used to form image. Blots were developed using ChemiDocTM Imager from Bio-Rad. The protein bands were quantitated with Image J software and normalized to β-actin.
2.11. Measurement of diacylglycerol (DAG)
An enzyme-linked immunosorbent assay (ELISA) kit (IL20977-96T, Shanghai Jianglai industrial Limited by Share Ltd, China) was used to measure rat diacylglycerol (DAG) according to the manufacturer’s instructions. The sciatic nerves were rinsed by precooling PBS to remove the residual blood. After weighing, the tissues were cut into pieces. The cut tissues and PBS of the corresponding volume (1mg: 9ul) were added into the glass homogenizer and fully ground on ice. If necessary, ultrasonic breaking or repeated freezing and thawing were carried out. Centrifugation at 5000rpm for 5min, and take the supernatant for test.
2.12. Apoptosis assay
An Annexin-FITC Apoptosis Detection Kit (556547, BD Biosciences, USA) was used to examine apoptosis according to the manufacturer’s instructions. In brief, cells were added with 300μL of binding buffer followed by staining with 5μL of FITC-labeled annexin V and 5μL of propidium iodide (PI) and incubated at room temperature for 20 min in the dark. After lentivirus transfected RSC96 cells, an Annexin-APC Apoptosis Detection Kit (E-CK-A218, Elabscience, China) was used to examine apoptosis according to the manufacturer’s instructions. Cells were added to 300μL of binding buffer followed by staining with 5μL of APC-labeled annexin V and 5μL of 7-Aminoactinomycin (7-AAD) and incubated at room temperature for 20 min in the dark.BD LSRFortessa™ flow cytometer (BD Biosciences, San Jose, CA, USA) were used for analysis.
2.13. Cell Counting Kit-8 (CCK8)
An Cell Counting Kit-8 (CK04-500T, Dojindo, Japan) was used to examine the activity according to the manufacturer’s instructions. RSC96 cell suspension (100ul/well, about 3000-5000 cells/well) was inoculated in 96- well plate and cultured in an incubator for 48 hours (37 ℃, 5% CO2). Add a 10ul CCK-8 solution to each hole (be careful not to generate bubbles in the hole, they will affect the reading of O.D value). Incubate the plates in the incubator for 2-4 hours. The absorbance at 450 nm was determined by enzyme scale.
2.14. Statistical analysis
Data were expressed as means ± SEM. Statistical analysis was performed by two-tailed Student’s t-test or one-way ANOVA using SPSS 17.0. A p value < 0.05 was considered statistically significant.