Patients and samples
Paraffin-embedded sections of ESCC tissues and adjacent normal tissues were prepared from 93 ESCC patients (71 males and 22 females, average age 64.1 ± 6.2-year-old) under radical esophagectomy from 2013 to 2014. None of the patients received neoadjuvant therapy before surgery. The tissue samples from primary tumor and regional lymph nodes were histologically examined with hematoxylin-eosin staining. The staging was confirmed according to International Union Against Cancer TNM classification 53. The differentiation was histologically subdivided into three levels: well-, moderate- and poor differentiation. The patients dying of surgery or causes other than esophageal cancer was excluded from this research. Demographic data including age, gender, stage, differentiation and histopathological factors were recorded and analyzed. All tissue samples were fixed in 10% formalin and embedded in paraffin wax. 4-µm serial sections were sliced and examined by immunohistochemistry (IHC). All animal experiments were approved by the Institutional Animal Care and Use Committee in Southwest Hospital of The Army Military Medical University and The First Affiliated Hospital of Chongqing Medical University. All the authors complied with the ARRIVE guidelines. All the animal experiments were performed in accordance with guidelines of animal care in Chongqing Medical University and The Army Medical University. All human experiments were approved by Ethical Committee in Southwest Hospital of The Army Military Medical University and The First Affiliated Hospital of Chongqing Medical University. The informed consent was obtained from all participants. All human experiments were performed in accordance with the guidelines of Helsinki Declaration.
IHC staining
The expression and distribution of Cldn3 was examined by IHC staining. Rabbit anti-Cldn3 polyclonal antibody (diluted 1:200; Abcam Inc，USA) was applied to detect Cldn3 expression. The semi-quantification of Cldn3 staining intensity was scored as follows: staining intensity was graded as 0 (negative), 1 (weak), 2 (moderate) and 3 (strong). The proportion of tumor cells with positive staining was graded as 0 (<5%), 1 (5‑25%), 2 (26‑50%), 3 (51‑75%) and 4 (>75%). A final score was achieved by multiplying the two scores. Final score of 0‑4 was defined as negative expression and score of 5-12 as positive expression 20.
Cell culture and protein extraction
Human ESCC cell lines including TE-1, TE-10, KYSE150 and Eca109 were cultured in RPMI 1640 medium supplemented with 10% fetal calf serum (FCS). At the indicated time point, total protein was extracted using cell lysis buffer (Beyotime Biotechnology, China).
RNA Interference
Three target siRNA sequences were selected from different loci of human CLDN3. First, the most effective siRNA against human CLDN3 were screened. The optimal small hairpin RNA (shRNA) cassette targeting human CLDN3 (CCGGCGACCGCAAGGACTACGTCTACTC_GAGTAGACGTAGTCCTTGCGGTCGTTTTTG) and a scrambled sequence (RiboBio Co. Ltd, Guangzhou, China) was transfected into TE-1 and Eca109 cell lines in 6-well plates using jetPRIME transfection reagent (Polyplus-Transfection, Illkirch-Graffenstaden, France) according to the manufacturer’s instructions. Transfected cells were treated with 200µM capsaicin and control medium. To confirm the efficacy of siRNA CLDN3, Cldn3 expression in transfected cells were measured by RT-PCR and Western Blot.
Lentiviral-mediated overexpression of Cldn3
The cDNA coding full-length human CLDN3 was amplified by PCR and cloned into the lentiviral vector pGag/Pol (Gene Pharma Co., CHN) (pLV-CLDN3). To produce a negative control virus (LV-NC), a short noncoding sequence was cloned into the lentiviral pGag/Pol and processed in parallel with the target gene. TE-1 and Eca109 cells (3×105) were transduced with pLV-CLDN3 and LV-NC using polybrene (5µg /ml). Transduced cells were treated with 200µM capsaicin or control medium. To confirm the efficacy of pLV-CLDN3, Cldn3 expression in transduced cells were measured by RT-PCR and Western Blot.
Western blotting
Target proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and electro-transferred to a nitrocellulose membrane (Bio-Rad, USA). Western blot was carried out by sequential incubation in 5% non-fat milk blocking buffer at room temperature for 60 min, using the following antibodies: rabbit anti-Cldn3 polyclonal antibody (1:2000, Abcam, USA), rabbit anti-E-cadherin monoclonal antibody (1:1000, Millipore, USA), rabbit anti-N-cadherin monoclonal antibody (1:1000, Millipore, USA), rabbit anti-Vimentin monoclonal antibody (1:2000, Millipore, USA). Following overnight incubation at 4℃, the secondary antibody was added and incubated for 60 min at 4℃. HRP-GAPDH (Kangchen, China) was applied as loading control.
RT-PCR
Total RNA was isolated and cDNA was reversal transcribed according to the manufacturer’s protocol. The mRNAs of target genes were measured by RT-PCR and analyzed by Rotor-Gene 3000 system (Corbett Research, Australia). Negative control was applied in each assay to ensure no contamination. All samples were detected in triplicate. The primer sequences were listed in Table 1.
Cell migration by wound healing assay
ESCC cell lines including KYSE150, TE-1, TE-10 and Eca109 were grown to confluence on 6-well plates and wounded by removing about 400µm-wide strips of cells across the well with a standard 200µl-pipette tip. After washing with HBSS, fresh culture medium was added and cells were incubated at 37℃ in a humid environment with 5% CO2. Wound closure was photographed every 15 mins by Nikon Eclipse Ti-S/L 100 microscope system. The experiments were performed twice and assayed in triplicate.
Cell invasion by Transwell assay
Cell invasion was evaluated using a Transwell chamber assay (Costar, USA). ESCC cell lines including TE-1, TE-10, Eca109, KYSE150 were serum starved for 24 h. Transwell inserts (BD Biosciences, USA) of 8mm-pore size were coated with 150 ml of 1:60 diluted Matrigel (BD Biosciences, USA). Cells (1×105) were plated onto the top of each coated filters in 150 ml serum-free medium. 300 ml of the same medium containing 20% FCS was placed in the lower chamber to act as a chemoattractant. After 24h incubation at 37°C, cells which did not move across the pores of Transwell inserts were manually removed with cotton swabs. The inserts were fixed in cold methanol for 10 mins followed by staining with 0.01% crystal violet in 20% ethanol. Cell counting was performed by Coomassie blue staining followed by visualizing under microscope (Leica, Germany). The experiments were performed twice and assayed in triplicate.
Tail vein metastatic assay
The tail vein metastatic assay was performed as previously described54. TE-1 cells (1 × 106) treated with capsaicin 200 μM or siRNA Cldn3 plus capsaicin 200 μM were injected intravenously into nude mice through tail vein. The mice were sacrificed at 8 weeks after treated TE-1 cells injection. The metastatic lesions of lungs were harvested and examined with histology. The number of metastatic foci from lungs were quantified. Eight mice were included in each group.
Statistical Analysis
For the data from histologic analysis, comparisons were assessed using the chi-squared test. Survival curve was performed by Kaplan–Meier method. The discrepancies in survival distributions were evaluated by log-rank test. Cox’s proportional hazards modeling was performed to confirm factors influencing on survival. For the data of RT-PCR and Western blotting, comparisons between groups were assessed by one-way ANOVA followed by Bonferroni’s test. The data were presented as the means ±SD. Statistical significance was estimated using SPSS version 19.0 software (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to a significant difference.