Detection and characterization of H5N1 HPAIV in environmental samples from a dairy farm

doi:10.21203/rs.3.rs-4422494/v1

Download PDF

Research Article

Detection and characterization of H5N1 HPAIV in environmental samples from a dairy farm

https://doi.org/10.21203/rs.3.rs-4422494/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 15 Jul, 2024

Read the published version in Virus Genes →

You are reading this latest preprint version

The recent expansion of HPAIV H5N1 infections in terrestrial mammals in the Americas, most recently including the outbreak in dairy cattle, emphasizes the critical need for better epidemiological monitoring of zoonotic diseases. In this work, we detected, isolated and characterized the HPAIV H5N1 from environmental swab samples collected from a dairy farm in the state of Kansas (USA). Genomic sequencing of these samples uncovered two distinctive mutations in the PB2 (E249G) and NS1 (R21Q) genes which are rare and absent in recent 2024 isolates of H5N1 circulating in the mammalian avian species. Additionally, approximately 1.7% of the sequence reads indicated a PB2 (E627K) mutation, commonly associated with the virus's adaptation to mammalian hosts. Phylogenetic analyses of the PB2 and NS genes demonstrated more genetic identity between this environmental isolate and the 2024 human isolate (A/Texas/37/2024) of H5N1. Conversely, HA and NA gene analyses revealed a closer relationship between our isolates and those found in other dairy cattle with almost 100% identity, sharing a common phylogenetic subtree. These findings underscore the rapid evolutionary progression of HPAIV H5N1 among dairy cattle and reinforces the need for more epidemiological monitoring which can easily be done using environmental sampling.

The H5N1 influenza virus is a highly pathogenic avian influenza A virus (HPAIV), commonly referred to as “H5N1 bird flu”. HPAIV is a highly contagious and deadly pathogen of avian and mammalian species. Initially identified in wild geese in China in 1996, the H5N1 virus has been circulating and spreading globally via wild bird reservoirs, causing high mortality in poultry and leading to increased human exposure that has resulted in sporadic, severe infections in humans^1,2. In 2022–2023, spillover events of avian H5N1 into wild mammals have resulted in mortality of a wide range of species. Increased instances of H5N1 infection in mammalian species, including seals, domestic and wild cats, red fox, skunk, mink, penguins, and humans, signals an alarming trend in the virus's evolutionary trajectory and underscores the need for a robust, diverse and continuous surveillance system for this virus in multiple species.

In early 2024, H5N1 was identified in US dairy cattle and the virus was isolated from the milk of the infected cows. The virus has since been detected in dairy products, a finding that could have far-reaching consequences for the dairy industry and food safety. To date, a total of 36 herds in 9 states have been confirmed to have infected cattle^3,4, with one confirmed human case presumed to be from exposure to the infected dairy cattle or their milk^5,6. This unique evolutionary trajectory of this pathogen into the bovine host presents veterinary medicine and public health with exceptional challenges. This unprecedented discovery of this pathogen’s tropism to the mammalian mammary glands prompts a re-evaluation of our understanding of H5N1's transmission dynamics and its potential impact on the agricultural sector. An additional challenge is surveillance of this pathogen on dairy farms; one potential solution is to employ environmental surveillance strategies. Here we present preliminary results and molecular epidemiology of some environmental testing that was performed at a dairy that was previously confirmed to have H5N1 infected cattle.

Characterization of the samples for Influenza A, H5, and N1 via real-time RT-qPCR:

Eleven environmental swab samples were received by the Kansas State Veterinary Diagnostic Laboratory (KSVDL) for testing. Four of the samples marked as rubber, 3 marked as plastic and 4 marked as concrete, denote the surface type sampled (Table 1). Ten of the 11 samples tested positive for Influenza A RNA as determined by the reverse transcription real-time polymerase chain reaction (RT-qPCR) assay for the Influenza A matrix gene with a cycle threshold (Ct) range of 24–33 with swabs from rubber surfaces generally yielding the lowest Ct values (Table 1 and Fig. 1)^7,8. Additional PCR testing included H5 and N1 genotyping typing assays, as detailed in Table 2 with similar Ct values (Table 1 and Fig. 1) ⁹. Furthermore, 9 of the 10 samples that were PCR positive for H5N1 RNA also yielded positive results when subjected to a RT-qPCR assay specifically designed for detection of the multi-basic cleavage site (MBCS) characteristic of the HPAIV in Eurasian HPAIV H5NX strains¹⁰. The presence of the MBCS denotes the RNA from a highly pathogenic influenza A virus in the sample. The 10th sample that yielded the highest Ct in the Matrix gene RT-qPCR was classified as suspect using the MBGC PCR, since only one PCR replicate was positive using this assay. Results of the PCR testing confirmed the presence of a highly pathogenic H5N1 Influenza A viral RNA in these environmental samples.

Table 1

RT-qPCR testing of environmental swabs from a dairy.
		FLU MATRIX H5		H5 TYPING		N1 TYPING		H5 MBCS
Sample Identifier	SAMPLE SOURCE	MEAN CT	STD CT	MEAN CT	STD CT	MEAN CT	STD CT	MEAN CT	STD CT
1	PLASTIC 1	32.95	0.36	33.15	0.21	32.04	0.53	31.17	0.05
2	CONCRETE 3	32.37	0.34	32.98	0.15	33.65	0.76	31.21	0.10
3	RUBBER 1	29.24	0.00	29.72	0.01	30.30	1.03	27.75	0.04
4	CONCRETE 4	35.27	0.20	34.33	0.24	35.66	0.49	33.48	0.94
5	RUBBER 1	27.61	0.02	28.21	0.03	27.95	0.06	26.15	0.03
6	PLASTIC 2	26.32	0.15	26.31	0.04	26.30	0.13	24.13	0.02
7	RUBBER 2	24.94	0.08	25.72	0.10	26.03	0.78	23.54	0.03
8	CONCRETE 1	33.38	0.24	34.26	0.02	33.98	0.79	32.97*
9	CONCRETE 2	ND		ND		ND		ND
10	PLASTIC 3	32.98	0.18	33.58	0.05	34.60	0.73	31.95	0.44
11	RUBBER 1	26.56	0.03	27.58	0.05	27.06	0.14	25.24	0.34
	*1/2 PCR replicates positive = suspect sample
STD = standard deviation
ND = not detected
MBCS = multibasic cleavage site (denoted high pathogenicity)

Table 2

PCR assays and sequences of the primers and probes used for characterization of samples.
PCR assays¹	forward primer	reverse primer	probe
Matrix (H5)	AGATGAGTCTTCTAACCGAGGTCG	TGCAAAAACATCTTCAAGTCTCTG	FAM-TCGGGCCCCCTCAAAGCCGA-MGB
		TGCAAAGACACTTTCCAGTCTCTG
H5 Typing	ACRTATGACTACCYCAGTATTCA	AGACCAGCTATCAYGATTGC	Cy5-TCWACAGYGGCGAGTTCCCTAGCA-3IAbRQSp
N1	GTTTGAGTCTGTTGCTTGGTC	TGATAGTGTCTGTTATTATGCC	NED-TTGTATTTCAATACAGCCAC-MGB
H5 MBCS	CCT TGC GAC TGG GCT CAG	ATC AAC CAT TCC CTG CCA	FAM-AGA AGA AAR AGA GGG CTG TTT GGG
			GCT-BHQ-1
1. 1X Stock concentrations of probes are 10 µM; 1X stock contraction of primers are 20 µM.

Characterization of the samples via Next Generation Sequencing (NGS).

All consensus sequences from samples with a Ct lower than 30 (rubber and plastic samples 3, 5, 6, 7 and 11) exhibited 100% similarity, indicating a probable common origin. The consensus sequences for all segments from sample 5 were submitted to NCBI GenBank (PP732373-PP732380) and GISAID (EPI_ISL_19091159; EPI_ISL_19091227-33) and confirmed to belong to clade 2.3.4.4b. Two amino acid substitutions were identified in the PB2 (E249G) and NS1 (R21Q) proteins, previously reported only in 0.35% and 0.33% respectively, of the submitted sequences in the GISAID database (Fig. 2). The PB2 protein harbors an E249G mutation, absent in both 2024 HPAIV dairy cattle and human isolates from Texas (A/Texas/37/2024)^5,6 (Fig. 2A). Additionally, approximately 1.7% of the total PB2 reads (5 out of 289) contain an E627K mutation, also found in a 2024 human isolate (A/Texas/37/2024)^5,6. The NS1 protein exhibits a R21Q mutation which is absent in all the available 2024 isolates sequenced to date as of May 8th, 2024, alongside an R40Q mutation, which is only present in other 2024 dairy cattle samples (Fig. 2B). The phylogenetic analysis of the PB2 protein shows that our isolate is genetically more identical to the recent mammalian 2024 isolates with a range of 99.86–98.09% identity compared to the isolates harboring the E249G mutation with a range of 97.95–96.45% identity (Fig. 2A). Similarly, phylogenetic analysis of the NS1 protein shows that our isolate is genetically more identical to the recent mammalian 2024 isolates with a range of 99.56–97.33% identity compared to the isolates harboring the R21Q mutation with a range of 96.44–89.33% identity (Fig. 2B).

Phylogenetic analysis of the HA and NA genes indicates that our isolate is genetically more similar to isolates from the year 2024 to date May 8th, 2024, with more than 99.74% identity and less than 11.26% gaps (Figs. 3 and 4). It is closely related to dairy cattle isolates with 100% identity and slightly less so to human isolates with only 99.74% identity. Conversely, phylogenetic analysis of the NS and PB2 genes shows a closer genetic relationship to human isolates with more than 99.54% identity and less than 4.31% gaps, while being more distant from dairy cattle isolates with an average of 99.64% identity and less than 7.30% gaps, which cluster together (Figs. 5 and 6).

The recent 2024 outbreak of highly pathogenic avian influenza virus (HPAIV) H5N1 on dairy cattle farms, and subsequent detection of the virus in raw and pasteurized milk, has raised significant concerns within the dairy industry, public health, and veterinary medicine^3,11. This incident marks a departure from previous instances of Influenza A virus in the bovine family, which typically exhibited resistance or subclinical infection¹². Our investigation identified the viral isolate across various environmental samples from a dairy farm in Kansas (USA).

The pathogenicity, virulence, and host specificity of influenza viruses can be primarily ascribed to the functions of three proteins: hemagglutinin (HA), polymerase basic protein 2 (PB2), and nonstructural protein 1 (NS1)¹³. Hemagglutinin plays a critical role in host species restriction, mediating viral entry through receptor-binding specificity¹⁴. PB2 is a pivotal element of the viral RNA polymerase complex, which also includes polymerase basic protein 1 (PB1), polymerase acidic protein (PA), and nucleoprotein (NP), orchestrating the synthesis of viral RNA¹³. Conversely, NS1, encoded by the NS gene segment, acts as an interferon antagonist, modulating the host's innate immune response to facilitate viral evasion^15,16. These genes’ evolutionary trajectories were investigated through comprehensive phylogenetic analysis. The phylogenetic analysis of the HA and NA genes from our isolate indicates a closer genetic resemblance to other 2024 isolates found in dairy cattle available to date May 8th, 2024. Furthermore, the isolate from a human case (A/Texas/37/2024) in Texas (USA), along with those from a cat, blackbird, skunk, and other isolates from the same year except for the goat isolate from Minnesota share a common phylogenetic subtree, suggesting a shared ancestry among these isolates. Similarly, the phylogenetic analysis of the NS and PB2 genes shows a closer genetic relationship to year 2024 isolates from dairy cattle, cat, skunk and human. However, unlike the HA and NA genes, PB2 and NS1 showed more similarity with the human isolate. This dichotomy in genetic affinity raises important questions about the virus's evolution and transmission.

The comprehensive analysis of mutations in our isolated strain revealed two novel amino acid substitutions in the PB2 and NS1 proteins, which have not been previously documented (Fig. 2). The E249G mutation in the PB2 protein, not observed in the 2024 HPAIV isolates from dairy cattle or humans to date and rarely presented in the nature, suggests a unique evolutionary trajectory for our strain. Conversely, the E627K mutation, detected in about 1.7% of the total PB2 reads and in a human isolate from 2024, raises the possibility of cross-species transmission. This mutation does not alter tissue tropism; however, it likely facilitates efficient viral replication in mammalian hosts ^17–20. Given that this mutation can emerge in Madin-Darby canine kidney (MDCK) cells, we employed both MDCK and egg-based cultures to isolate the virus from our sample²¹. Additionally, the R21Q mutation in the NS1 protein is rare in nature and exclusive to our strain, and the R40Q mutation found in other dairy cattle isolates from 2024, were identified. While there is a lack of data on these specific mutations, existing literature indicates that even a single amino acid alteration in NS1 can significantly affect viral pathogenicity^13,17.

The 2024 H5N1 outbreak in dairy cattle in the USA represents a significant deviation from previous patterns of influenza resistance in cattle and a previously unreported tropism of this virus to replicate in the mammary gland. The discovery of unique mutations in the PB2 and NS1 proteins suggests a novel evolutionary trajectory for this virus isolate, with implications for interspecies transmission and viral pathogenicity. This study also reports the utility of environmental surface samples as a means of rapid surveillance and a source of acceptable material for molecular epidemiology. These findings underscore the importance of ongoing surveillance and research to understand the evolutionary dynamics of HPAIV and its impact on both animal and human health.

Sample collection and initial screening:

Eleven environmental swab samples from a dairy farm in Kansas, USA (Table 1) were received by the KSVDL from a veterinarian. Samples were subjected to universal influenza A detection polymerase chain reaction (RT-qPCR) assay.

RNA extraction from reported positive samples:

All samples that tested positive at the KSVDL were subsequently subjected to additional RT-qPCR assays for more detailed characterization. Samples were handled in a BSC and treated as suspect samples under BSL3-like conditions. The RNA extraction process involved swabs immersed in gel transport media: each container held two swabs, one affixed to the cap and the other unattached within the gel. The unattached swab was placed into 200 µl of RLT lysis buffer (Qiagen) combined with 150 µl of PBS, while the primary swab was submerged in 3 ml of DMEM media with 1X penicillin-streptomycin (Corning). Both swabs underwent vortexing in their respective solutions for 40 seconds in 10-second intervals and were then maintained at ambient temperature for 10 minutes prior to extraction. For the automated bead extraction, 300 µl of the media and 200 µl of the RLT lysate were utilized in the Biosprint 96-well magnetic bead extraction system (Qiagen), employing the Total NA extraction kit (Gene Reach) and adhering to the manufacturer's instructions with two alterations: firstly, beads were introduced to the lysis buffer before the sample, followed by 200 µl of molecular-grade isopropanol (ThermoFisher), and secondly, the final wash buffer B was substituted with 200 proof molecular-grade ethanol (ThermoFisher). To ensure the validity of the extraction process, positive controls (pH1N1 virus in DMEM and deactivated H5N8 RNA) and negative controls (nuclease-free water: ThermoFisher) were incorporated.

Reverse transcription Real-time PCR (RT-qPCR) assays for detection Influenza A, H5, N1 and MBCS:

RNA extracted from positively reported samples underwent four distinct RT-qPCR assays as detailed in Table 2. The Influenza A Matrix gene was detected using a one-step RT-qPCR, employing a modified M + 64 probe with an adenine to guanine nucleotide substitution at position 66^7,8. Two separate RT-qPCR assays facilitated the detection of H5: the first, an in-house H5 typing assay for avian Influenza H5, and the second, a specific assay for the HPAI virus H5 MBCS within the 2020/21 clade 2.3.4.4b H5Nx viruses, termed HP H5 rRT-PCR⁹. This assay's probe binds directly over the cleavage site, with specificity for the MBCS characterized by the amino acid sequence REKRRKR’GLF. The N1 phenotype was ascertained using a one-step RT-qPCR with a previously established N1 detection assay¹⁰. All RT-PCRs utilized qScript XLT One-Step RT-qPCR Tough Mix (Quanta Biosciences), incorporating a 20-minute reverse transcription phase, followed by 45 amplification cycles at 95°C for 10 seconds and 60°C (matrix assay) or 55°C (all other assays) for 1 minute. Amplifications were conducted on either the Biorad CFX or the Applied Biosystems QS5, using a 20 µl reaction volume containing 5 µl of RNA, 0.5 µl of primers, and 0.2 µl of probes for typing assays, or 0.2 µl of each for the matrix assay.

Each sample was analyzed in duplicate wells, with each plate including duplicate wells of PCR positive controls for Influenza A, H5, and N1. Four wells served as non-template controls. A positive Ct cut-off of 35 cycles was established for samples where both wells were positive. Samples with one positive well at or below a Ct of 35 were classified as suspect-positive. Suspect-positive samples were immediately transferred to the BSL-3 + laboratory at the Biosecurity Research Institute at Kansas State University.

Whole-genome sequencing by Oxford Nanopore Minion.

Samples exhibiting a Ct value below 30 were earmarked for whole genome sequencing to confirm the presence of MBCS. RNA extracted from samples 3, 5, 6, 7, and 11 underwent amplification of all full-length segments employing universal primers and the One-step Superscript III PCR mix (ThermoFisher), following the protocol outlined by Hoffman et al ^22,23. After amplification, PCR products were purified using AMPure XP beads (Beckman Coulter) in accordance with the manufacturer’s guidelines. These purified products were then subjected to end-repair, converting the DNA to a blunt-ended form with 5′ phosphates and 3′-hydroxyls, utilizing the NEBNext® End Repair Module (NEB). A second purification step was performed using AMPure XP beads (Beckman Coulter), as per the manufacturer’s protocol. Finally, the purified, repaired DNA was prepared for sequencing with the Oxford Nanopore’s Rapid barcoding kit (SQK-RBK004), again following the manufacturer’s instructions.

Sequencing data analysis and phylogenetic tree construction:

The sequencing process yielded raw fastq files, which were utilized for the subsequent sequence characterization of the samples. These raw reads underwent alignment with the recent H5N1 genomes from both human and dairy cattle sources (Human: PP599470-PP599477; Dairy cattle: PP577940-PP577947), employing the CLC Genomic Workbench (Qiagen) and SeqMan Ultra Version 17.6 (DNASTAR). Following alignment, the consensus sequences derived from the software and reference genomes were meticulously compared to construct the final confirmed consensus sequences. These confirmed sequences were then submitted to the NCBI GenBank (PP732373-PP732380) and GISAID (EPI_ISL_19091159; EPI_ISL_19091227-33) databases. Subsequent analyses of the consensus sequences for sequence similarity were conducted using NCBI BLASTn and MegaAlign Pro Version 17.6 (DNASTAR)^24,25. The top 100 BLASTn results from NCBI and the most recent H5N1 sequences from the 2024 GISAID submissions were downloaded and aligned via the Clustal Omega algorithm in MegaAlign Pro Version 17.6 (DNASTAR). The aligned sequences served as the basis for constructing a maximum-likelihood phylogenetic tree with the RAxML-NG algorithm in MegaAlign Pro Version 17.6 (DNASTAR)²⁶. Bootstrap consensus trees, derived from 100 replicates for each segment and featuring unique amino acid changes, along with HA and NA, were further examined using Mega11^27,28.

Unique amino acid changes:

The consensus sequences submitted were utilized to detect distinctive amino acid alterations through the NCBI BLASTp tool, and by comparison with mammalian H5N1 protein sequences from the 2024 GISAID database. These protein sequences underwent alignment and subsequent analysis employing the Clustal Omega algorithm and RAxML-NG algorithm within MegaAlign Pro Version 17.6 (DNASTAR)^24–26.

Competing Interests

The J.A.R. laboratory received support from Tonix Pharmaceuticals, Xing Technologies and Zoetis, outside of the reported work. J.A.R. is inventor on patents and patent applications on the use of antivirals and vaccines for the treatment and prevention of virus infections, owned by Kansas State University, Manhattan, KS, USA.

Author Contribution

G.S., J.D.T., J.R., J.A.R. designed and conceptualized the study. G.S., J.D.T., C.D.M., S.K.,T.K., I.F., F.M.-F., L.N. acquire the data. G.S., J.D.T., C.D.M. analyzed and interpret the data. G.S., J.D.T., C.D.M.,T.K, N.N.G. wrote the manuscript. J.R. and J.A.R. acquired funding and supervised the study.

Data Availability

Sequence data that support the findings of this study have been deposited in the National Center for Biotechnology Information with the GenBank accession number PP732373 to PP732380 and Global Initiative on Sharing All Influenza Data with the accession number EPI_ISL_19091159; EPI_ISL_19091227-33.

Claas EC et al (1998) Human influenza A H5N1 virus related to a highly pathogenic avian influenza virus. Lancet 351:472–477
Senne DA et al (1996) Survey of the Hemagglutinin (HA) Cleavage Site Sequence of H5 and H7 Avian Influenza Viruses: Amino Acid Sequence at the HA Cleavage Site as a Marker of Pathogenicity Potential. Avian Dis 40:425–437
Highly Pathogenic Avian Influenza (HPAI) Detections in Livestock | Animal and Plant Health Inspection Service. https://www.aphis.usda.gov/livestock-poultry-disease/avian/avian-influenza/hpai-detections/livestock
CDC. Avian Influenza Current Situation Summary (2024) Centers for Disease Control and Prevention https://www.cdc.gov/flu/avianflu/avian-flu-summary.htm
CDC Newsroom (2016) CDC https://www.cdc.gov/media/releases/2024/p0401-avian-flu.html
Uyeki Timothy M et al Highly Pathogenic Avian Influenza A(H5N1) Virus Infection in a Dairy Farm Worker. N Engl J Med 0
Kwon T et al (2024) Pigs are highly susceptible to but do not transmit mink-derived highly pathogenic avian influenza virus H5N1 clade 2.3.4.4b. 2023.12.13.571575 Preprint at https://doi.org/10.1101/2023.12.13.571575
Sponseller BA et al (2010) Influenza A Pandemic (H1N1) 2009 Virus Infection in Domestic Cat. Emerg Infect Dis 16:534–537
James J et al (2022) Rapid and sensitive detection of high pathogenicity Eurasian clade 2.3.4.4b avian influenza viruses in wild birds and poultry. J Virol Methods 301:114454
Payungporn S et al (2006) Single step multiplex real-time RT-PCR for H5N1 influenza A virus detection. J Virol Methods 131:143–147
Burrough ER et al Early Release - Highly Pathogenic Avian Influenza A(H5N1) Clade 2.3.4.4b Virus Infection in Domestic Dairy Cattle and Cats, United States, 2024 - 30, Number 7—July 2024 - Emerging Infectious Diseases journal - CDC. 10.3201/eid3007.240508
Sreenivasan CC, Thomas M, Kaushik RS, Wang D, Li F (2019) Influenza A in Bovine Species: A Narrative Literature Review. Viruses 11:561
Neumann G, Chen H, Gao GF, Shu Y, Kawaoka Y (2010) H5N1 influenza viruses: outbreaks and biological properties. Cell Res 20:51–61
Neumann G, Kawaoka Y (2006) Host Range Restriction and Pathogenicity in the Context of Influenza Pandemic. Emerg Infect Dis 12:881–886
Krug RM, Yuan W, Noah DL, Latham AG (2003) Intracellular warfare between human influenza viruses and human cells: the roles of the viral NS1 protein. Virology 309:181–189
García-Sastre A et al (1998) The Role of Interferon in Influenza Virus Tissue Tropism. J Virol 72:8550–8558
Hatta M, Gao P, Halfmann P, Kawaoka Y (2001) Molecular Basis for High Virulence of Hong Kong H5N1 Influenza A Viruses. Science 293:1840–1842
Puthavathana P et al (2005) Molecular characterization of the complete genome of human influenza H5N1 virus isolates from Thailand. J Gen Virol 86:423–433
Shinya K, Watanabe S, Ito T, Kasai N, Kawaoka Y (2007) Adaptation of an H7N7 equine influenza A virus in mice. J Gen Virol 88:547–553
Shinya K et al (2004) PB2 amino acid at position 627 affects replicative efficiency, but not cell tropism, of Hong Kong H5N1 influenza A viruses in mice. Virology 320:258–266
Subbarao EK, London W, Murphy BR (1993) A single amino acid in the PB2 gene of influenza A virus is a determinant of host range. J Virol 67:1761–1764
Zhou B, Wentworth DE, Influenza (2012) A Virus Molecular Virology Techniques. In: Kawaoka Y, Neumann G (eds) Influenza Virus: Methods and Protocols. Humana, Totowa, NJ, pp 175–192. doi:10.1007/978-1-61779-621-0_11.
Hoffmann E, Stech J, Guan Y, Webster RG, Perez DR (2001) Universal primer set for the full-length amplification of all influenza A viruses. Arch Virol 146:2275–2289
Nucleotide BLAST Search nucleotide databases using a nucleotide query. https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome
Sievers F et al (2011) Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7:539
Kozlov AM, Darriba D, Flouri T, Morel B, Stamatakis A (2019) RAxML-NG: a fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics 35:4453–4455
Russo CADM, Selvatti AP (2018) Bootstrap and Rogue Identification Tests for Phylogenetic Analyses. Mol Biol Evol 35:2327–2333
Tamura K, Stecher G, Kumar S (2021) MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38:3022–3027

Competing interest reported. The J.A.R. laboratory received support from Tonix Pharmaceuticals, Xing Technologies and Zoetis, outside of the reported work. J.A.R. is inventor on patents and patent applications on the use of antivirals and vaccines for the treatment and prevention of virus infections, owned by Kansas State University, Manhattan, KS, USA.

Download PDF

Journal Publication

published 15 Jul, 2024

Read the published version in Virus Genes →

Editorial decision: Revision requested
28 May, 2024
Reviews received at journal
25 May, 2024
Reviewers agreed at journal
18 May, 2024
Reviews received at journal
18 May, 2024
Reviewers agreed at journal
16 May, 2024
Reviewers invited by journal
16 May, 2024
Submission checks completed at journal
15 May, 2024
Editor assigned by journal
15 May, 2024
First submitted to journal
15 May, 2024

You are reading this latest preprint version

Detection and characterization of H5N1 HPAIV in environmental samples from a dairy farm

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

Characterization of the samples for Influenza A, H5, and N1 via real-time RT-qPCR:

Discussion

Conclusion

Material and Methods

Sample collection and initial screening:

RNA extraction from reported positive samples:

Reverse transcription Real-time PCR (RT-qPCR) assays for detection Influenza A, H5, N1 and MBCS:

Sequencing data analysis and phylogenetic tree construction:

Unique amino acid changes:

Declarations

Author Contribution

Data Availability

References

Additional Declarations

Status:

Journal Publication

Version 1