Cell lines
Baby hamster kidney (BHK-21) cells were purchased from the Japanese collection of research bioresources (JCRB) cell bank. They were maintained in Minimum Essential Medium (MEM) (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum (FBS) (Sigma-Aldrich), penicillin (100 units/mL) (Nacalai Tesque, Kyoto, Japan), and streptomycin (100 µg/mL) (Nacalai Tesque), at 37°C with 5% CO2. When transfected with TNCL replicons, cells were incubated at 30°C. Human embryonic kidney (HEK 293T) cells were purchased from ATCC (Manassas, VA, USA) and were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) (Sigma-Aldrich) supplemented with 10% FBS, penicillin, and streptomycin. High Five insect cells were purchased from Thermo Fisher Scientific (Waltham, MA, USA), and cultured in SF-900 II SFM medium (Gibco-Thermo Fisher Scientific) in the absence of FBS or additional antibiotics, at 27°C. Vero cells were purchased from ATCC and maintained in DMEM, supplemented with 10% FBS, penicillin, and streptomycin.
Mice
All experiments and protocols were approved by the Animal Care and Use Committee of Osaka University and BIKEN. Seven-week-old BALB/c female mice were used to test the immunogenicity of SFV replicons in vivo. Mice were immunized with two doses of SFV replicon prepared with either U or 1mY (1 µg of RNA/30 µL/dose) administered intra-muscularly, three weeks apart, and sera was analyzed by ELISA three weeks after the second dose. Two independent experiments using 3 or 5 mice per group were performed. The mice were kept in a temperature- and light-controlled room at the animal facility of Osaka University with free access to food and water. Methods are reported in accordance with the ARRIVE guidelines.
Cloning of TNCL and CVB3 genomes
High Five cells (Thermo Fisher Scientific) were infected with a baculovirus to induce the reactivation of the TNCL nodavirus that is latently present in this cell line30. Four days later, the supernatant was collected and subjected to ultra-centrifugation (100,000 × g, 4 h) over a 10% sucrose cushion at 4°C. The pellet containing the virus was resuspended in PBS and stored at -80°C until use. Viral RNA was extracted from an aliquot of the stored virus using TriReagent (Molecular Research Center, Cincinnati, OH, USA) following the manufacturer’s protocol. The cDNA of TNCL genomic RNA1 and RNA2 were synthesized using SuperScript III reverse transcriptase (Thermo Fisher Scientific) according to the procedure described by Li et al30, and cloned into Invitrogen’s pCR4 Blunt TOPO plasmid (Thermo Fisher Scientific). To clone the CVB3 genome, Vero cells were infected with the Nancy strain of CVB3 (ATCC VR-30). Three days later, the supernatant was collected and viral RNA was extracted using TriReagent (Molecular Research Center), as described above for TNCL. The cDNA of CVB3 was synthesized with SuperScriptIII, and used as a template to amplify two viral fragments containing the required additional flanking sequences: the hammerhead ribozyme50 was inserted upstream of the 5’UTR, and a poly(A)25 tail was added downstream of the region encompassing P2 to the 3’UTR, in addition to a Mlu I site, used to linearize the plasmid for IVT51,52. These sequences were then added to the primers used for PCR. The EMCV IRES sequence was separately amplified from the pAAV-IRES-Puro expression vector (Cell Biolabs, San Diego, CA, USA) with an inserted Hpa I restriction site in the 5’end. These three fragments were assembled into pcDNA3.1 plasmid (Invitrogen) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs).
Generation of various viral replicons
TNCL RNA1-based replicons. We used the WT TNCL RNA1-containing TOPO vector as the backbone to be modified for different purposes. We constructed template plasmids for IVT by adding the T7 promoter and terminator sequences, and other regulatory sequences such as the hepatitis virus D ribozyme, based on a previous report53. SFV-based replicons. A LacZ SFV-based replicon (pSFV3-LacZ) was purchased from Addgene (Watertown, MA, USA) (plasmid #92074)54 and used as the backbone for the SFV replicons tested in the current study, replacing the LacZ sequence with that of GFP-HiBiT (Fig. 4a) or the SARS-CoV-2 spike protein RBD-TM (Fig. 4e). For the CVB3-based reporter experiments, the sequence encoding GFP-HiBiT was inserted into the Hpa I site using the wild-type replicon described above.
In vitro transcription (IVT)
TNCL template plasmids were linearized with Not I restriction enzyme (New England BioLabs, Ipswich, MA, USA) and purified using a Qiagen gel extraction kit (Qiagen, Hilden, Germany). One microgram of the digested plasmid was used for each reaction using the MEGAscript T7 transcription kit (Invitrogen), where 1mΨ triphosphate (TriLink, San Diego, CA, USA) was used instead of the U triphosphate contained in the kit (or a mixture), where necessary. Capping was performed using 50 µg of RNA with ScriptCap Cap1 system reagent (CellScript, Madison, WI, USA). This procedure was the same for mRNAs but required polyA tailing, which was performed using a poly(A) tailing kit (Invitrogen). In vitro transcription of CVB3 replicons was performed following the same protocol, but omitting the capping reaction. CVB3 replicons were constructed on a pcDNA3.1 vector background, and linearized with Xha I (New England BioLabs) restriction enzyme prior to IVT. Plasmids encoding SFV replicons were linearized with Spe I (New England BioLabs) restriction enzyme for IVT using the MEGAscript SP6 transcription kit (Invitrogen), following the procedure described above, as well as the capping step. The polyA tailing reaction was not necessary in this case because the polyA tail was encoded within the template plasmid and was thus generated during the IVT reaction.
Transfection of cells was performed with Lipofectamine2000 reagent (Invitrogen) at a ratio of 150 ng of RNA/µL of reagent.
Assessment of GOI expression from the replicons
The expression of the GFP-HiBiT reporter at the protein level was confirmed by fluorescence microscopy (Keyence BZ-X710, Osaka, Japan) and luminescence measurements (HiBiT, Promega, Madison, WI, USA) of lysates with the same total protein content. To confirm replication, quantitative real-time PCR was performed to detect viral and GOI RNAs. The primer sequences are listed in Table 1. Total RNA was extracted from the transfected cells using the RNeasy Plus kit (Qiagen) following the manufacturer’s instructions. Five hundred to 1000 ng of RNA was used for reverse transcription using random oligomers and the PrimeStar RT kit (Takara, Shiga, Japan). Where indicated, cDNA was prepared using virus-specific primers and SuperScript III first-strand synthesis system for RT-PCR (Invitrogen). Real-time PCR was performed using Applied Biosystems PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) in a QuantStudio1 thermal cycler (Applied Biosystems). Relative expression to the initial analyzed time point was calculated following the 2ΔΔCt method, using hamster gapdh or human GAPDH genes as internal controls for normalization. The details of the primers used are listed in Table 1. For Western blot analysis of the RBD-TM-encoding SFV replicon, an anti-RBD Ab (40592-T62 SinoBiological, Wayne, PA, USA) was used and was detected with HRP-labeled anti-rabbit IgG Ab (Sigma-Aldrich AP307P). Human GAPDH was used as a protein-loading control and was detected using mouse anti-human GAPDH (Abcam ab8245, Cambridge, England) and anti-mouse IgG-HRP (Sigma-Aldrich).
Table 1
Primers used in the current study
Primer name | Sequence | Target | Assay |
RNA1_F | AAAGTGAGCGGCTTTGATGC | TNCL gRNA1 | qPCR* |
RNA1_R | TTGTAAAAACCATTCCTTCC |
hGapdh_F | TCTTCCAGGAGCGAGATCCC | Hamster gapdh |
hGapdh_R | ACTTGTCATGGTTCACACCC |
GAPDH_F | CACATCGCTCAGACACCATG | Human GAPDH |
GAPDH_R | TGACGGTGCCATGGAATTTG |
GFP_F | AAGTTCATCTGCACCACCGG | GFP |
GFP_R | AGAAGATGGTGCGCTCCTGG |
SFV_F | GAGCTGAAAGAACTGACGCCG | Semliki forest virus gRNA |
SFV_R | CGGCCTGATCTTCAGCCC |
RBD_F | CGCCGACTACAATACAAGC | SARS-CoV-2 spike mRNA |
RBD_R | GCTCGAAGGGCTTCAGATTG |
RT_RNA1 | CGGTCATGGTGGCGAATAAAACCAACAATCGAAGAACGC | TNCL (-) RNA1 | RT** |
Tag | CGGTCATGGTGGCGAATAA | qPCR |
GFP_R2 | AACTTCAGGGTCAGCTTGCCGTAGGTGGC |
Sequence of the primers used for detection of the indicated target mRNAs or viral RNAs (gRNA) by real-time PCR |
* qPCR: quantitative real-time PCR |
** RT: reverse transcription |
Immuno-fluorescent staining
TNCL or SFV replicons were transfected into BHK-21 cells, which had been pre-seeded onto glass slides and placed inside the wells of a 12-well plate. At 24 hpt, the glass slides were removed, washed with PBS, and fixed with a 4% paraformaldehyde solution for 15 min at room temperature. After washing again with PBS, the cells were permeabilized with 0.5% solution of Triton X-100 in PBS. Blocking with 0.5% BSA in PBS (for 30 min at room temperature) was performed before staining with anti-dsRNA antibody (Ab) (Millipore, Burlington, MA, USA). Detection was performed using an Alexa568-labeled anti-mouse IgM Ab (Abcam) and observed under a Keyence BZ-X710 fluorescence microscope. The same procedure was performed on HeLa cells transfected with CVB3 replicons.
RNA immunoprecipitation (RIP)
BHK-21 cells were transfected with HA-tagged IRES-PA mRNA and defective TNCL replicons in vitro-transcribed with either U or 1mΨ. Lysates were collected at 48 hpt and RIP was performed using the Magna RIP RNA-binding protein immunoprecipitation kit (Millipore) with an anti-HA tag Ab (Thermo Fisher Scientific, cat# 26183) or mouse isotype control IgG (Invitrogen cat# 02-6100), following the manufacturer’s instructions. Ten percent of the raw lysate was processed in parallel with the precipitated samples for RNA extraction using TriReagent (Molecular Research Center), and the RNA pellet was dissolved in 20 µL of water. The precipitated RNA (2 µL) was used for cDNA synthesis using a SuperScript III reverse transcription kit (Invitrogen) with random hexamers. A standard curve was constructed using the RNA of the raw lysates (input), and the amount of precipitated RNA was expressed as “percentage of input.” TNCL viral RNA1 in the precipitated RNA was detected by RT-qPCR using the primers listed in Table 1.
Formulation of SFV replicons for in vivo experiments
In vitro-transcribed SFV replicons containing the SARS-CoV-2 spike RBD-TM coding sequence were encapsulated in lipid nanoparticles, prepared with: ssPalmE-P4C2 (NOF Co, Tokyo, Japan), 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylen glycol 2000 (NOF Co.), 1,2-dioleolyl-sn-glycero-3-phosphoetyanoamine (DOPE) (Avanti Polar lipids Inc., Alabama, USA), and cholesterol (Sigma-Aldrich), as previously described55 and using a microfluidics device, kindly provided by Manabu Tokeshi and Masatoshi Maeki of Hokkaido University.
Enzyme-linked immune-sorbent assay (ELISA)
Plates were coated with recombinant RBD peptide dissolved in PBS (1 µug/mL, 100 µL/well, 96-well plates), and were incubated at 4 ˚C overnight. Wells were washed three times using 0.05% Tween20 in PBS, and blocking was performed with a solution of 1% BSA (Sigma-Aldrich) in PBS at room temperature for 2 h. After another washing step, aliquots of serially diluted serum from immunized mice were added to the coated plates and incubated at room temperature for 2 h. The dilution buffer consisted of PBS with 1% BSA and 0.05% Tween20. Goat horseradish peroxidase-labeled anti-mouse Ab (Sigma-Aldrich) was used to detect RBD-specific antibodies together with the BioFix TMB One component HRP microwell substrate (Surmodics, MN, USA). A solution of 0.5 N HCl was used to stop the reaction, and the optical density was measured at 450 nm using an SH-9000 microplate reader (Corona Electric, Ibaraki, Japan).
Statistical analysis
Statistical analysis was performed using GraphPad Prism version 9.4.1 (Graphpad Software LLC). Figures were generated using the same software. The details of each analysis are provided in the corresponding figure legends.