2.1 Bacterial Strains and Growth Conditions
The E. coli strain D5 was obtained from the mucus within the uterus of Holstein cows that were diagnosed with clinical endometritis (Wang et al., 2020; Zhang et al., 2024). The control strain for sensitivity to medications, E. coli ATCC 25922, was acquired from the American Type Culture Collection. The strains were preserved at a temperature of -80 ℃ in a microbiology laboratory situated at the Lanzhou Institute of Husbandry and Pharmaceutical Sciences, which is affiliated with the Chinese Academy of Agricultural Sciences and is situated in Lanzhou, China. The bacterial strains were cultivated by agitating them at a temperature of 37°C in Nutrient-Broth-Medium for a duration of 24 hours before the experiment.
2.2 Determination of Minimum Inhibitory Concentrations (MICs) and Minimum Bactericidal Concentrations (MBCs)
The MICs and MBCs of linalool (Sigma-Aldrich, USA) versus E. coli D5 and ATCC 25922 were ascertained employing the broth microdilution technique (Kwieciński et al., 2009) with some changes. Linalool was subjected to serial two-fold dilutions, with volumes ranging from 0.25 to 128 µL/mL in Mueller-Hinton (MH) broth containing 1% dimethyl sulfoxide (DMSO) (v/v) and E. coli was infected with 1 x 105 CFU/mL. In addition, various controls were established, such as a solvent control consisting of test bacteria and MH broth with 1% DMSO, a bacterial control consisting of test bacteria and MH broth, a blank control consisting of MH broth with 1% DMSO and corresponding linalool concentrations, a blank solvent control consisting of MH broth with 1% DMSO, and a blank medium consisting of MH broth. Three replicates were employed to test the MIC and MBC.
2.3 Estimation of Minimum BF Inhibitory Concentrations (MBICs) and Minimum BF Eradication Concentrations (MBECs)
The MBICs of linalool against E. coli D5 and ATCC 25922 were measured employing the microdilution technique with small adjustments (Al-Shabib et al., 2017). Linalool was subjected to serial two-fold dilutions, with volumes ranging from 0.25 to 128 µL/mL in Luria-Bertani (LB) broth containing 1% DMSO and E. coli was infected with 1 x 107 CFU/mL. Furthermore, the experimental configuration included multiple controls: a solvent control, which comprised LB broth containing test bacteria and 1% DMSO; a bacterial control, which comprised LB broth and test bacteria; a blank control, which comprised LB broth containing 1% DMSO and varying doses of linalool; a blank solvent control which comprised LB broth containing 1% DMSO; and a blank medium, which comprised LB broth. The bacteria were cultivated for 24 h at 26°C. Following that time, the medium was withdrawn. BF was stained with a 0.3% (w/v) crystal violet solution. The examination of absorbance was performed at 600 nm utilizing a BioTek Synergy LX multi-mode reader (Agilent, USA). MBIC of Linalool was found to be the lowest concentration at which it produced a minimum of 90% decrease in BF formation, contrasted with the control group without linalool.
The MBECs of linalool against E. coli D5 and ATCC 25922 were measured employing the microdilution technique, with slight adjustments (Ramage et al., 2001). The bacteria (1 × 107 CFU/mL) were cultivated at 26°C for 24 hours and then the samples underwent three rounds of washing with PBS. Subsequently, BF was treated with linalool in serial two-fold dilutions from 0.25 µL/mL and progressing up to 128 µL/mL. Furthermore, several controls were implemented, including the solvent control (consisting of LB broth with BF and 1% DMSO), the BF control (consisting of LB broth with BF), the blank control (consisting of LB broth with 1% DMSO and the matching linalool concentrations), the blank solvent control (consisting of LB broth with 1% DMSO), and the blank medium (consisting of LB broth). After incubating for another 24 h at 26°C, Finally, the specimen was stained with a 0.3% (w/v) solution of crystal violet, and the detections were carried out using the previously indicated procedure. The MBEC of linalool was identified as the smallest concentration at which at least 80% of BFs were eradicated, compared to the control group lacking linalool.
2.4 Planktonic Time-dependent Killing Assay
E. coli D5, with an initial concentration of 1 x 105 CFU/mL, was subjected to incubation at 37°C. During this process, linalool was introduced at ultimate concentrations: 0, 1, 2, and 4 µL/mL 1% DMSO of MH broth. At time intervals of 5, 15, and 30 minutes, as well as 1, 2, 4, 8, 12, and 24 hours, a volume of 100 µL solution was extracted from each sample and then diluted in a series. Afterward, they were inoculated onto MH agar and placed in an incubator at 37°C for 24 hours. Ultimately, the quantity of functional E. coli cells was ascertained by the enumeration of the colonies that were produced. The minimum detectable concentration was 10 CFU/mL. Readings were acquired at time 0 before the addition of linalool. Measurements were carried out in three distinct experiments. Time-kill curves were generated by plotting the average colony counts (log10 CFU/mL) versus time.
2.5 Determination of BF Inhibition
The linalool implications on the suppression of BF creation by E. coli D5 were evaluated by employing the microdilution approach with slight changes (Al-Shabib et al., 2017). Bacterial suspensions were prepared in LB broth at a concentration of 1 × 107 CFU/mL and they were treated with linalool at concentrations of 0, 1, 2, and 4 µL/mL in 1% DMSO of LB broth at 26°C. The specimens were gathered at certain time intervals of 5, 15, and 30 minutes, as well as 1, 2, 4, 8, 12, 24, 48, 72, and 96 hours. The BF was then identified using the crystal violet technique described earlier.
2.6 BF Time-dependent Killing Assay
Firstly, 100 µL of E. coli D5 suspension (2 × 107 CFU/mL) was introduced to each individual well in a 96-well microplate. A solution of linalool was produced by adding 0, 2, 4, and 8 µL/mL to an LB medium containing 1% DMSO (v/v). Each group received a 100 µL solution of linalool. The culture plates were incubated at 26°C for varying amounts of time, for 5, 15, and 30 min, and 1, 2, 4, 8, 12, 24, 48, 72 and 96 hours. The culture media was removed and then washed three times with PBS. Following the addition of 200 µL of LB broth to each well, 40 µL of CCK-8 solution (CCK-8, Beyotime Biotechnology, China) was then added to the wells containing the BF. The measurement of absorbance was determined at a specific wavelength of 450 nm after a period of incubation of 2 hours at 37°C. The assessments were conducted in three separate trials.
2.7 Analysis with Scanning Electron Microscopy (SEM)
The impact of linalool on the development of BFs was investigated using SEM using a previously established protocol with slight adjustments (Kang et al., 2018). E. coli D5 was grown in LB broth containing 1% DMSO (v/v) with linalool added at doses of 0, 1, 2, and 4 µL/mL. The bacterial concentration was 1 x 107 CFU/mL. The specimens were cultured to generate BFs on an 8 mm glass coverslip placed in a 24-well polystyrene plate. The culture was left undisturbed for 24 h at 26°C. In addition, there was a control for antibiotics at a dose of 2 mg/mL of ampicillin. The specimens were treated with 2.5% glutaraldehyde for 4 hours, rinsed with PBS, and then subjected to a stepwise dehydration process employing various levels of ethanol (30, 50, 70, 85, 90, and 100%) for 15 minutes each. Once the specimens were dried, they underwent a gold coating process using a sputter coater. After that, they were imaged utilizing an SEM (JSM-5600, JEOL, Japan).
2.8 Confocal Laser Scanning Microscopy (CLSM) Analysis
The linalool implications on living bacteria throughout the process of BF development were investigated by employing CLSM. E. coli D5 (1 × 107 CFU/mL) were cultured with linalool at final amounts of 0, 1, and 2 µL/mL for 24 hours without agitation at 26°C. The BFs were stained for a duration of 15 minutes using the LIVE/DEAD BacLight Bacterial Viability Kit (Molecular Probes, Invitrogen, France). Subsequently, the specimens were cleansed using PBS and seen using a CLSM (LSM 700, Zeiss, Germany). The excitation/emission peaks for PI were at 305/617 nm, whereas for SYTO 9, they were roughly 483/500 nm. Each sample was photographed in six fields, and all samples were examined in three separate tests. The CLSM pictures were processed using COMSTAT to measure the biomass of both living and deceased cells (Heydorn et al., 2000; Vorregaard, 2008).
The CLSM was also used to observe the alterations in EPS throughout the process of BF development. E. coli D5 (1 × 107 CFU/mL) were exposed to linalool at final doses of 0, 1, and 2 µL/mL for 24 h at a constant temperature of 26°C without agitation. The BFs were stained using FITC-ConA/PI double staining. The specimens were treated with a 4% solution of paraformaldehyde for a duration of 10 minutes. Then, they were stained in a light-restricted environment using FITC-ConA for 15 min. Finally, they were treated with PI for a duration of 10 minutes. The excitation/emission peaks for FITC-ConA stain were at 495/519 nm, whereas for PI, they were roughly 305/617 nm. Following the staining process, the specimens were rinsed with PBS and visualized using a CLSM. Each sample consisted of six fields, and all samples were conducted in three separate trials. The CLSM pictures were further analyzed using COMSTAT to quantify the biomass of EPS and bacteria.
2.9 Quantification of EPS, Protein, and DNA in BF
Each well of 96-well sterile polystyrene plates was supplemented with about 107 CFU/mL of E. coli D5, along with linalool solutions at concentrations of 0, 1, 2, and 4 µL/mL. The plates were thereafter placed in an incubator set at 26°C for 24 h to facilitate the BF growth. The wells were subsequently rinsed with PBS in a gentle manner to remove any plankttonic microorganisms. After the samples were allowed to dry naturally, 200 µL of physiological saline solution was introduced to each well. Ultrasonication was used to disturb the BF. The identical samples were combined and subjected to centrifugation at a force of 5000 g for a duration of 30 minutes. The liquid portion was employed to quantify the concentration of EPS, proteins, and DNA. The EPS content in the BF was quantified using the phenol-H2SO4 reagent. The protein content in the BF was estimated by employing a BCA protein assay kit (Beijing Solarbio Science & Technology Co., China). The DNA was isolated by deploying a bacterial DNA kit (Omega, America). The OD260 nm was measured employing a UV-visible spectrophotometer (Liu et al., 2017).
2.10 RNA Extraction and RT-qPCR Detection of PgaABCD Expression
The bacterial cells in the E. coli D5 BF, cultivated on 96-well polystyrene plates, were collected following the procedure described above, both with and without the presence of linalool. The RT-qPCR method was deployed to examine the transcription levels of pgaABCD in E. coli that were either treated with linalool or left untreated while undergoing BF formation. The gene-specific primers for RT-qPCR may be found in Table 1. The RNA isolation process was carried out utilizing a Bacterial RNA Kit (OMEGA, America). By means of reverse transcription, cDNA was produced employing a PrimeScript™ reagent Kit in conjunction with a gDNA Eraser (Takara, Japan). Utilizing TB Green™ Premix Ex Taq™ II (Takara, Japan) and the Applied Biosystems QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific Inc., America), the RT-qPCR amplifications were conducted. Each sample underwent three separate tests. The determination of relative gene expression was conducted utilizing the 2–ΔΔCt method.
2.11 Statistical Analysis
Statistical analysis was conducted utilizing SPSS Statistics 25 (SPSS Inc., America). A one-way ANOVA was utilized to find significant variations within the data. Variations were deemed significant at p < 0.05.
Table 1
Specific primers for pgaABCD used for quantitative RT-PCR.
Gene | Primer | Sequence (5'-3') |
pgaA | pgaA-F pgaA-R | AGGCTTATGTTCGCTGGTATC TAGTATGGGGTATCGTGTTCTG |
pgaB | pgaB-F pgaB-R | AAACATCCCTCAGGCTAAAGAC CATTCAGTTGTAATAGGCTCATCC |
pgaC | pgaC-F pgaC-R | GGCGTCTATTTCTGGGTCTATC GCGGCGTGTATGGTTTCC |
pgaD | pgaD-F pgaD-R | TCTGCTGACGGGTTATTACTG TTGCGGCGTATATTGGTAGG |
16S | 16S-F 16S-R | CTGGAACTGAGACACGGTCC GGTGCTTCTTCTGCGGGTAA |