KHAT cell line and culture media
Human keratinocytes were isolated from normal human skin in patients undergoing plastic surgery and grown in keratinocyte serum-free medium (KSFM) supplemented with 50 µg/mL bovine pituitary extract and 0,5 ng/mL epidermal growth factor (Gibco; Thermo Fisher Scientific) in a humidified atmosphere of 5% CO2 at 37°C. The KHAT cell line was generated through immortalization of human primary keratinocytes following transduction with a lentiviral vector expressing hTERT and a large tumor antigen (also called large T-antigen). Transduced keratinocytes were cultivated in parallel with the non-transduced cells in KSFM. Immortalization was considered to occur when KHAT cells grew for 50 population doublings beyond the life span of the parental keratinocytes. These immortalized cells formed a normally stratified epidermis when used in organotypic culture (Figure S1A). KHAT cells can also form pigmented epidermis when human primary melanocytes are incorporated in skin equivalents (Figure S1B).
UVB irradiation procedure
KHAT cells were irradiated at a dose of 15 mJ.cm-2 using a Biotronic device (Vilber Lourmat, Marne la Vallée, France), equipped with a dosimeter, in which the UVB lamp emitted a continuous band between 280 and 380 nm (major peak at 312 nm), as previously described50. To determine the optimal dose, a propidium iodide (PI) exclusion assay was initially performed to evaluate the viability of keratinocytes following irradiation at different doses. The viability of irradiated keratinocytes was approximately 70% compared with that of the non-irradiated controls 24 h after irradiation at a dose of 15 mJ.cm− 2 (Figure S1). This dose was selected for further experiments. For photoactivation of CPD photolyase after irradiation, the cells were incubated for 30 min under 450 nm blue light in a 37°C 5% CO2 incubator.
Quantification of CPDs by immunodot blot analysis
CPDs were quantified as described previously12,51,52. Briefly, dry pellets were incubated for 3 h at 65°C in DirectPCR Lysis Reagent (Euromedex, Souffelweyersheim, France) supplemented with 2% proteinase K (Sigma-Aldrich). DNA was extracted by using sodium acetate/ethanol precipitation and quantified on a Nanodrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA). Next, 500 ng of genomic DNA was mixed with 1% SYBR Green (Brilliant III Ultra-Fast SYBR; Agilent Technologies, Les Ulis, France) and dot-blotted onto a Hybond N + nitrocellulose membrane (Amersham, Little Chalfont, UK). The membranes were blocked for 30 minutes (20 mmol/L Tris-buffered saline, 5% nonfat dry milk, 0.5% Tween 20, pH 7.6) and incubated with an anti-CPD monoclonal antibody (1:1,000, CosmoBio) overnight at 4°C. The membranes were washed in Tris-buffered saline (TBS) and incubated for 1 hour with a horseradish peroxidase-conjugated secondary antibody (1:2,000, Vector Laboratories). The blots were developed with an enhanced chemiluminescence reagent (Bio-Rad, Hercules, CA). SYBR green fluorescence was used as a loading control.
lentiviral vector constructs and keratinocyte transduction
The lentiviral vector expressing nuclear photolyase-mCherry was a generous gift from Dr. Jurgen A Marteijn (University Medical Center Rotterdam, Rotterdam, Netherlands)53. This vector was used for constructing a mitochondrial-targeted CPD photolyase construct by inserting the mitochondrial targeting signal (MTS) taken from the human Tfam gene (atggcgtttctccgaagcatgtggggcgtgctgagtgccctgggaaggtctggagcagagctgtgcaccggctgtggaagtcgactgcgctcccccttcagttttgtgtatttaccgaggtggttt) into N-terminus of the photolyase-mCherry.
Lentiviral particles were produced by transient transfection of 293T cells using a calcium phosphate transfection technique as previously described14,50. Determination of the titer of each viral supernatant was performed by assessing mCherry protein expression via flow cytometry.
For transduction, keratinocytes (5 × 105 cells/T25 flask) were incubated for 24 h in complete medium. Prior to infection, the medium was removed, and the cells were incubated with the viral supernatants for 24 h at 37°C. After 5 days, the percentage of mCherry fluorescent protein-positive cells was determined via immunohistochemistry (Figure S3) and flow cytometry.
Proteomic analysis
Sample preparation for proteomic analysis
KHAT, Nu-PL KHAT, Mt-PL KHAT, and HaCaT cells were exposed to a single dose of UVB (15 mJ.cm-2). Following irradiation, the cells were arrested at different time points post-irradiation (2, 5, 9, 24, and 48 hours). Three separate experimental series were conducted for KHAT, while four series were performed for HaCaT. The dry cell pellets were subsequently subjected to proteomic analysis, as previously described51,52. Proteins were extracted with RIPA buffer [Tris-HCl, pH 8, 50 mM; NaCl, 150 mM; sodium dodecyl sulfate, 0.1%; NP40, 1%; sodium deoxycholate, 0.5%; and protease inhibitor cocktail (Sigma)] using a Precellys device with CK14 beads (Bertin, Ozyme, France), and the lysates were centrifuged for 20 min at 12 500 rpm and 4°C. A BCA kit (23225, Pierce, Rockford, MD, USA) was used to measure the protein concentration in each sample. The samples were deposited in triplicate onto SDS-PAGE. Separation was stopped once the proteins had entered the resolving gel. After colloidal blue staining, the bands were excised from the SDS-PAGE gel and subsequently cut into 1 mm x 1 mm gel pieces. The gel pieces were destained in 25 mM ammonium bicarbonate 50% ACN, rinsed twice in ultrapure water and shrunk in ACN for 10 min. After removal of ACN, the gel pieces were dried at room temperature, covered with trypsin solution (10 ng/µl in 50 mM NH4HCO3), rehydrated at 4°C for 10 min, and finally incubated overnight at 37°C. The spots were then incubated for 15 min in 50 mM NH4HCO3 at room temperature with rotary shaking. The supernatant was collected, and an H2O/ACN/HCOOH (47.5:47.5:5) extraction solution was added to the gel slices for 15 min. The extraction step was repeated twice. The supernatants were pooled, dried in a vacuum centrifuge, and resuspended in 25 µl of formic acid (5%, v/v) to inject about 500 ng.
nLC-MS/MS analysis
The peptide mixture was analyzed on an Ultimate 3000 RSLC Nano-UPHLC system (Thermo Scientific) coupled to a Fusion Lumos mass spectrometer (Thermo Scientific). Ten microliters of peptide digests were loaded onto a 300-µm-inner diameter x 5-mm C18 PepMap™ trap column (LC Packings) at a flow rate of 30 µL/min. The peptides were eluted from the trap column onto an analytical 75-mm id x 15-cm C18 Pep-Map column (LC Packings) with a 4–40% linear gradient of solvent B in 108 min (solvent A was 0.1% formic acid in 5% ACN, and solvent B was 0.1% formic acid in 80% ACN). The separation flow rate was set at 300 nL/min. The mass spectrometer was operated in positive ion mode at a 1.8-kV needle voltage. The data were acquired in a data-dependent mode. MS scans (m/z 300–2000) were recorded at a resolution of R = 70 000 (@ m/z 200) and an AGC target of 1 x 106 ions collected within 100 ms. Dynamic exclusion was set to 30 s and the top 15 ions were selected from fragmentation in HCD mode. MS/MS scans with a target value of 1 x 105 ions was collected with a maximum fill time of 120 ms and a resolution of R = 35 000. Additionally, only + 2 and + 3 charged ions were selected for fragmentation. Other settings were as follows: spray voltage, 1.8 kV; no sheath or auxiliary gas flow;heated capillary temperature, 200°C; normalized HCD collision energy, 25%; and an isolation width of 3 m/z.
Database search and results processing
Protein identification and label-free quantification (LFQ) were performed via Proteome Discoverer. The Sequest HT algorithm was used for protein identification by searching against the UniProt Reference Proteome Set database of Homo sapiens (77 895 entries in UniProt 2021-03). Two missed enzyme cleavages were allowed. The mass tolerances used for MS and MS/MS were set to 10 ppm and 0.6 Da, respectively. Oxidation of methionines (+ 16 Da), methionine loss (-131 Da), methionine loss with acetylation (-89 Da) and protein N-terminal acetylation (+ 42 Da) were considered as variable modifications, while carbamidomethylation of cysteines (+ 57 Da) was considered as a fixed modification. Peptide validation was performed using the Percolator algorithm 54 and only ‘high confidence’ peptides were retained, corresponding to a 1% FDR at the peptide level. The Minora feature detector node (LFQ) was used along with the feature mapper and precursor ion quantifier. The normalization parameters used were as follows: (i) unique peptides, (ii) precursor abundance based on intensity, (iii) normalization mode: total human peptide abundance, (iv) protein abundance calculation: summed abundances, (v) protein ratio calculation: pairwise ratio based and (vi) hypothesis test: t-test (background based). Quantitative data were considered for master proteins, quantified by a minimum of two unique peptides and a p value lower than 0.05.
The mass spectrometry proteomics data have been deposited in the ProteomeXchange Consortium via the PRIDE 55 partner repository with the dataset identifier PXD051736.
Targeted LC-MS metabolomics profiling analysis
Dry pellets of KHAT cells were collected each from 10 cm petri dishes and subjected to metabolomic analysis. Metabolites were extracted from cells using 400 µL of cold extraction solvent (acetonitrile:methanol:MQ; 40:40:20), after which the samples were vortexed for 2 minutes and sonicated for 1 minute (settings: sweep mode, frequency 37, power 60, no heating), followed by centrifugation at 14000 rpm at 4°C for 5 minutes. The supernatants were transferred into polypropylene tubes and placed into a nitrogen gas evaporator, after which the dried samples were suspended in 40µL of extraction solvent (acetonitrile:methanol:MQ; 40:40:20), vortexed for 2 minutes and subsequently transferred to HPLC glass autosampler vials. Two microliters of sample was injected with a Thermo Vanquish UHPLC coupled with a Q-Exactive Orbitrap quadrupole mass spectrometer equipped with a heated electrospray ionization (H-ESI) source probe (Thermo Fischer Scientific). A SeQuant ZIC-pHILIC (2.1×100 mm, 5-µm particle) column (Merck) was used for chromatographic separation. The gradient elution was carried out with a flow rate of 0.100 ml/minute using 20 mM ammonium hydrogen carbonate and adjusted to pH 9.4 with ammonium solution (25%) as mobile phase A and acetonitrile as mobile phase B. The gradient elution was initiated from 20% mobile phase A and 80% mobile phase B and maintained for 2min. The elution was followed by 20% mobile phase A gradually increasing up to 80% for 17 min and then 80–20% mobile phase A decreasing for 17.1 min and maintained for up to 24 minutes. The column oven and autosampler temperatures were set to 40 ± 3°C and 5 ± 3°C, respectively. The MS instrument was equipped with a heated electrospray ionization (HESI) source using polarity switching and the following settings: resolution, 35,000; spray voltage, 4250 V for positive and 3250 V for negative mode; sheath gas, 25 arbitrary units (AU); auxiliary gas, 15 AU; sweep gas flow, 0; capillary temperature, 275°C; and S-lens RF level, 50.0. Instrument control operated with Xcalibur 4.1.31.9 software (Thermo Fisher Scientific). The peak integration was performed with TraceFinder 4.1 software (Thermo Fischer Scientific) using confirmed retention times for 58 metabolites standardized with the library kit MSMLS-1EA (Merck). The data quality was monitored throughout the run using pooled QC samples prepared by pooling 5 µL from each suspended sample and interspersed throughout the run as per the 10th sample. The metabolite data were checked for peak quality (poor chromatograph), % RSD (20% cutoff) and carryover (20% cutoff).
Metabolomics data analysis
The data was analyzed with MetaboAnalyst 5.0 (https://www.metaboanalyst.ca). Missing variables were imputed using KNNVAR. The values were normalized to total ion count for combined positive + negative polarity (0.0 to 17 min, range 55–825 m/z), log-transformed and auto-scaled. The following statistical analyses were performed. Multivariate clustering analysis was performed for heatmap with distance measurements using the Euclidean algorithm and a clustering algorithm using the ward.D.
Measurement of lactate production and glucose consumption
To measure lactate production and glucose consumption, we used YSI 2950 Biochemistry Analyzer (YSI Life Sciences) which applies immobilized enzymes to catalyze the corresponding chemical reactions to measure the concentration of a specific metabolite. Briefly, cells were irradiated in 6 well plates. Once the cells were irradiated, 1 mL of KSFM complete medium was added to each well. At 5 h and 24 h, 200 µl of medium were taken and put in duplicate in a 96-well plate. The concentrations of glucose and lactate in the collected medium were evaluated by YSI analyzer using fresh corresponding medium as a reference. The results were normalized to the total protein level.
Oxygen consumption, extracellular acidification and mitochondrial complex- dependent respiration
A Seahorse XF94 Extracellular Flux Analyzer (Seahorse Bioscience) was used. The results were normalized to the total protein level. The assay medium for measuring glycolytic capacity was XF Base medium (Agilent) supplemented with penicillin (100 IU/mL) and streptomycin (100 mg/mL) adjusted to pH 7.4. The assay medium for respiration via each mitochondrial complex consisted in XF Base medium supplemented with D-glucose (10 mM), sodium pyruvate (1 mM), penicillin (100 IU/mL), and streptomycin (100 mg/mL) adjusted to pH 7.4. Four wells contained no cells to control temperature-sensitive fluctuations in O2 fluorophore emission. One hour before monitoring, the plates were incubated in a CO2-free incubator at 37°C for 1 hour to allow temperature and pH equilibration. The microplates were subsequently placed into an XF96 and allowed to equilibrate for 15 min before the first measurement. The XF assays consisted of 3 min of mixing, 3 min of waiting, and 2 min of measurement cycles and were performed at 37°C as described elsewhere 56. Using this protocol, it was possible to calculate an O2 consumption rate every 8 min. Drugs of interest prepared in the requisite assay medium were preloaded into reagent delivery chambers A, B, C, and D at 10X,11X,12X, and 13X of the final working concentration, respectively, and injected sequentially at intervals of 24 min as indicated. The substrates used for glycolytic capacity and OXPHOS capacity were added as indicated in the figures at the following final working concentrations: oligomycin (10µM), glucose (20g/L), 2-DG (50 mM), rotenone (10 µM), antimycin A (10 µM), digitonin (4 mM), succinate (25 mM), and DNP (50 µM). In each 96-well plate, cells from each cell lines were seeded in 4 or 6 wells.
Respiration via each mitochondrial complex was also evaluated using digitonin-permeabilized cells in the presence of the proper substrates and inhibitors of the other complexes. CI-, CII-, CIII-, and CIV-linked respiration was measured by evaluating the oxygen consumption rate after consecutive addition of the following substrates: rotenone (1 µM), succinate (100 mM), antimycin A (10 µM), ascorbate (10 mM) and TMPD (100 µM).
Western blot procedure
Western blotting was performed as previously described26. Briefly, equal amounts of total protein were resolved by SDS–polyacrylamide gel electrophoresis (SDS–PAGE) and electrophoretically transferred to nitocellulose membrane for AMPK and p-AMPK; and to a PDVF membrane for OXPHOS. The membranes were then incubated overnight at 4°C with primary antibodies (Table 1). After additional incubation with a 1:1000 dilution of an anti-immunoglobulin horseradish peroxidase-linked antibody (Vector Laboratories, Biovalley S.A., Marne la Vallée, France) for 1 h, blots were developed using the chemiluminescence ECL reagent (Bio-Rad).
Mitochondrial mass
The mtDNA/gDNA ratio was assessed using qRT-PCR with Brilliant III SYBR Master Mix (Agilent) on a Bio-Rad Real-Time PCR equipment (Bio-Rad CFX96 wells). The following specific primers were used to amplify the fragments of mtDNA and gDNA: mtDNA, forward primer (GATTTGGGTACCACCCAAGTATTG) and reverse primer (ATTATTCAATGGTGGCTGGCAGTA); gDNA, forward primer (AAGAGGAGAGTGGGAGTGATGA) and reverse primer (ACTGCTTGAAGAGCTTGAGCAT). The PCR program was 95°C for 10 min; 40 cycles at 95°C for 15 sec and 60°C for 30 sec. The duplicate Cq values were averaged. The mtDNA/gDNA ratio was calculated as follows: mtCq/gCq.
Immunofluorescence and confocal microscopy
Cells were plated in 12 well plates on glass coverslips (thickness:1,5 mm) and cultured in medium until they reached 60% confluency at the time of irradiation. After 10 minutes of fixation with 3.4% formaldehyde and permeabilization with 0.1% Triton X-100, the cells were saturated for 30 minutes in a 5% bovine serum albumin solution. The TOM20 antibody (Table 1) was incubated overnight at 4°C. After washing three time with PBS buffer, the cells were incubated with Atto 647 N antibody for 1h. The cells were then incubated with Alexa Fluor™ 488 Phalloidin antibody for 1h and DAPI. Images were acquired on a Leica DMI6000 TCS SP8X confocal inverted microscope with a 63X oil objective. Hardware and image acquisition were controlled with LAS X Life Science software. A z stack of seven images was collected and subjected to 2-D deconvolution to obtain a single in-focus field with out-of-focus information removed.
Mitochondrial morphology analysis
Mitochondrial morphology was assessed by machine deep learning (Mitosegnet) as described elsewhere57. Briefly, forty 3D confocal images of the mitochondrial network were preprocessed for segmentation at each irradiation time point and for each cell type. The image size was 1024*1024 with a pixel size between 80–83 nm. The data were analyzed with the associated MitoA software. We used GraphPad Prism with principal component analysis (PCA) for each morphological parameter to determine the most relevant irradiation time for which the mitochondrial network was affected. The 2 largest eigenvalues were chosen for the principal component.
Statistics
Comparisons between two groups were performed using Student’s t-test (two-tailed), and a p value < 0.05 (*) was considered to indicate statistical significance. The results were presented as the means +/- SEM. Comparisons between more than two groups were performed with one-way analysis of variance (ANOVA) followed by Bonferroni’s multiple comparison test if the values normally distributed (Shapiro and Wilk test). If the data were not normally distributed, a nonparametric Kruskal‒Wallis test associated with Dunn’s multiple comparison test was performed. If two independent variables needed to be tested, two-way ANOVA followed by a post hoc Bonferroni correction was used. If the distribution did not follow normality, a mixed-effects model followed by Bonferroni correction was used for multiple comparisons. A p value < 0.05 was considered to indicate statistical significance. The results are presented as the means +/- SEMs. PCA was performed using GraphPad Prism software.