Mice and surgery
Mouse experiments were performed according to guidelines established by the Institutional Animal Care and Use Committee of Nantong University. The ICR mice used for the experiments were obtained from the Laboratory Animal Center of Nantong University. Primary dorsal root ganglion (DRG) neurons were isolated from newborn ICR mice (postnatal day 0-1). Eight-week-old adult male ICR mice (25-30 g) were used to construct the PNI models, including a sciatic nerve crush model and a sciatic nerve chronic constriction injury model (CCI). The sciatic nerve crush injury model was established according to our previous report [15]. Briefly, after anaesthetization with isoflurane, the left sciatic nerve of the mouse was squeezed with no. 5 jeweler's forceps for 20 seconds. In some cases, a diluted fluorescent dye (0.5 μl of Vybrant CM-Dil in 20 μl of PBS) was injected into the hind paw on the injured side at 7 days after nerve crushing, and L5 DRG sections were examined seven days later. The CCI model was produced by placing three ligatures (7-0 Prolene, 1 mm intervals) around the left sciatic nerve proximal to the trifurcation. The ligatures were softly tied until a short flick of the ipsilateral hind limb occurred [16]. The mice in the sham group were subjected to the surgery described above but not to nerve injury. The mice were separated into groups (5 mice per cage) and housed under standard conditions (25 ± 1°C, 12-h light/dark cycle, ad libitum access to food and water).
Reagents and administration
Capsaicin (catalog: 404-86-4) and NGF (catalog: 01-170) were purchased from Sigma-Aldrich. Maresin 1 (7R,14S-dihydroxy-docosa-4Z,8E,10E,12Z,16Z,19Z- hexaenoic acid) was purchased from Cayman Chemical Company (catalog: 1268720-28-0). Vybrant CM-Dil Cell-Labeling Solution was purchased from Invitrogen (catalog: V22885). A sterilized hemostatic gelatin sponge containing 500 ng of MaR1 or saline (control) was immediately applied locally to the injured nerve after crushing, and the wound was then closed. Drugs in 20 μl of PBS were intraplantarly injected using a Hamilton microsyringe with a 30-G needle. The spinal cord was punctured with a 30-gauge needle between the L5 and L6 levels for intrathecal drug delivery.
Cell culture
DRG neurons were harvested from newborn ICR mice and then subjected to explant culture or dissociated culture as previously described [17]. In brief, ND7/23 rat DRG/mouse neuroblastoma hybrid cells were obtained from Sigma-Aldrich and maintained in DMEM supplemented with 10% FBS, 2 mM L-glutamate and 10% penicillin/streptomycin.
Whole-cell patch-clamp recordings in dissociated mouse DRG neurons
As we described previously [18], whole-cell patch-clamp recordings in dissociated DRG neurons (small size, <25 mm) harvested from 4- to 6-week-old mice were performed at room temperature using an Axopatch-200B amplifier (Axon Instruments, USA). The patch pipettes were pulled from borosilicate capillaries (Chase Scientific Glass Inc., Rockwood, TN, USA), and their resistance when filled with the pipette solution (in mM: 126 K-gluconate, 10 NaCl, 1 MgCl2, 10 EGTA, 2 NaATP, and 0.1 MgGTP, adjusted to pH 7.3 with KOH) was 4-5 MΩ. Whole-cell recordings were performed in an extracellular solution (in mM): 140 NaCl, 5 KCl, 2 CaCl2, 1 MgCl2, 10 HEPES, 10 glucose, adjusted to pH 7.4 NaOH. A voltage clamp was applied at a holding membrane potential of -70 mV to record the inward currents, and the recording chamber (300 µl) was superfused continuously (3-4 mL/min). We compensated for series resistance (>80%) and performed leak subtraction. The data were low-pass filtered at 2 kHz and sampled at 10 kHz, and pClamp10 (Axon Instruments) software was used for the experiments and data analysis.
Behavioral analysis
A total of four double-blind behavioral tests were used. 1) Walking track (footprint) analysis was used to analyze basic motor functions, and the sciatic function index (SFI) was calculated as previously reported [15]. In brief, the plantar surface of each mouse's hind paw was smeared with ink, and the mouse was allowed to walk in a straight path on white paper. 2) The rotarod test was used to test complex motor functions as previously reported [19]. Briefly, mice were tested three times at 10-minute intervals, and the time spent on the rod was recorded and averaged. During the test, the speed was increased from 2 to 20 rpm over a three-minute period. 3) The von Frey test was used to test mechanical sensitivity as previously reported [18]. Briefly, the mice were placed in a box on an elevated metal mesh floor and stimulated with a series of von Frey filaments of logarithmically increasing stiffness (0.02–2.56 gf; Stoelting) on their hind paws. The 50% paw withdrawal threshold was determined by Dixon’s up-down method. 4) Using a Hargreaves radiant heat apparatus (IITC Life Science) as previously reported [19], we tested the thermal sensitivity. The basal paw withdrawal latency was adjusted to 9 to 12 seconds with a cutoff of 20 seconds to avoid tissue damage.
Immunofluorescence assay
As we described previously [20], the mice were deeply anesthetized with isoflurane, and their ascending aortas were perfused first with PBS and then with 4% paraformaldehyde. After perfusion, the L4-L6 spinal cord segments were collected and then postfixed overnight. The spinal cord sections were sliced at a thickness of 30 µm (free-floating) on a cryostat and processed for immunohistochemistry analysis. The sections were first blocked with 2% goat serum at room temperature for one hour and then incubated at 4°C overnight with the following primary antibodies: anti-ATF-3 (rabbit, 1:1000, Santa Cruz Biotechnology Inc.), anti-GFAP (mouse, 1:1000, EMD Millipore), anti-IBA1 (rabbit, 1:1000; Wako Chemicals Inc., USA) and anti-NF200 (mouse, 1:1,000, Sigma, catalog: N0142). After washing, the sections were incubated at room temperature for two hours with the following secondary antibodies (1:400, Jackson ImmunoResearch): Cy3-donkey anti-rabbit (catalog: 711-165-152) and FITC-donkey anti-mouse (catalog: 715-095-150). The stained sections were observed and photographed with a Leica fluorescence microscope.
Muscle atrophy test
After the administration of MaR1 for nine days after CCI, the gastrocnemius muscles from both hind legs were separated for imaging and weight measurements. The muscle size and weight were used to assess muscle atrophy.
Quantitative real-time RT-PCR
Total RNA was collected from ipsilateral and contralateral spinal dorsal horn tissues using TRIzol reagent (Life Technologies, USA), and 1 µg of RNA was reverse-transcribed using the PrimeScript RT reagent kit (Takara, Dalian, China). Gene-specific mRNA analyses were performed using the MiniOpticon Real-Time PCR system (BioRad), and the mRNA expression levels were calculated using the 2-ΔΔCt method. The specific primers, including those for the GAPDH control, were synthesized by Thermo Fisher Scientific, and the sequences were as follows: IL1β (forward TACATCAGCACCTCACAAGC, reverse AGAAACAGTCCAGCCCATACT), IL-6 (forward TCCATCCAGTTGCCTTCTTGG, reverse CCACGATTTCCCAGAGAACATG), TNF-α (forward CCCCAAAGGGATGAGAAGTT, reverse CACTTGGTGGTTTGCTACGA) and GAPDH (forward TTGATGGCAACAATCTCCAC, reverse CGTCCCGTAGACAAAATGGT).
Western blot analysis
Total proteins were extracted from ND7/23 cells with RIPA lysis buffer (Beyotime, Shanghai, China) containing a protease inhibitor cocktail and phosphate inhibitors (Roche Molecular Biochemicals, Inc. Mannheim, Germany). The proteins were separated on 8% or 10% SDS-PAGE gels and electrophoretically transferred onto PVDF membranes. The membranes were blocked with 5% nonfat milk for 1-2 h and then incubated with antibodies against phosphorylated AKT (p-AKT) (1:1000, rabbit, Cell Signaling, catalog: 9271), AKT (1:1000, rabbit, Cell Signaling, catalog: 9272), phosphorylated ERK (p-ERK) (1:1000, rabbit, Cell Signaling, catalog: 9101), total ERK (1:1000, rabbit, Cell Signaling, catalog: 9102), phosphorylated mTOR (p-mTOR) (1:1000, rabbit, Cell Signaling, catalog: 2971), mTOR (1:1000, rabbit, Cell Signaling, catalog: 2972), phosphorylated PI3K (p-PI3K) (1:1000, rabbit, catalog: 4228), PI3K (1:1000, rabbit, Cell Signaling, catalog: 4292), and GAPDH (1:10000, mouse, Proteintech, catalog: 60004-1-lg) overnight at 4°C. The next day, the membranes were incubated with the corresponding secondary antibody at room temperature for 2 h. Bands were detected using PierceTM ECL western blotting substrate (Thermo, USA), and the results were analyzed by ImageJ software.
Statistical analyses
All data are expressed as the mean ± SEM, as indicated in the figure captions. Student’s t-test (two groups) or ANOVA (one-way and two-way) was used to compare the differences between groups, followed by Bonferroni’s test. The criterion for statistical significance was P < 0.05.