A total of 163 patients with histologically documented LUAD based on GSTM1 (-/+), GSTTI (-/+), and GSTP1 I105V genotypic variants were enrolled. A subset of untreated 80 stratified cases (from 163 patients) containing adequate formalin-fixed paraffin-embedded (FFPE) tissue samples were selected to assess the relative risk of P53 phenotypic (expression/mutation) status and DNA damage in LUAD cases. This protocol was approved by the Human Ethics Committee (IEC No.-11/16) of Dr. Ram Manohar Lohia Institute of Medical Sciences (Dr.RMLIMS), Lucknow, India. This protocol complied with the 1996 Declaration of Helsinki. Informed consent was obtained from all participants.
Samples collection
A 4 mL blood sample was collected from all study subjects (with a self-administered questionnaire containing demographic information, smoking, and medical history) visiting the outpatient department (OPD) facility, Respiratory Medicine Department, King George’s Medical University (KGMU), Lucknow, India. Blood samples were collected in EDTA (01 mL) and heparin (03 mL) vials from the participants. EDTA samples were immediately stored at -80 0C for genotyping, and 03 mL of blood from newly diagnosed untreated cases (n=48) was used for lymphocytic DNA damage. For each participant, FFPE tumor tissue was retrieved for P53 expression (Immunohistochemistry).
DNA extraction:
According to the manufacturer’s recommendations, genomic DNA was extracted from whole blood using a Genomic DNA mini extraction kit (Invitrogen, USA). The extracted DNA was quantified and checked for purity by using a NanoDrop spectrophotometer (DS-11-spectrophotometer, Bio-rad, USA).
Genotypes analysis:
Detection of GSTT1 (+/-) GSTM1 (+/-) null and GSTP1 (Ile 105 Val) genotype:
Polymerase chain reaction determined GSTT1 genotype. A 20 µL PCR reactions have 100 ng of DNA, 0.8 μM of primers for GSTT1 (F5’-TTCCTTACTGCTCATC-3’ R5’- TCACCGGATCGCCAGCA-3’) and 0.5μM primers (F5’-GCCCTGCTAACACCTAC-3’ R5’GCCCTAAAAAAAAAAATCGCCAATC-3’) for albumin gene and 12 µL EmeraldAmp GT PCR Master Mix (2X Premix) (Takara Bio, Japan). The amplification
conditions were denaturation at 98°C for 10 s, followed by 35 cycles of annealing at 64°C for 45 s, and extension at 72°C for 1 min (Thermocycler Bio-Rad, USA). PCR products were resolved on a 1.2 % agarose gel stained with ethidium bromide (EtBr). After electrophoresis, GSTT1 (+/+) Fuc. genotype showed two bands of 480 bp and 375 bp, but only 375 bp showed GSTT1 (-/-) null genotype (SupplementaryFig.1a). The albumin gene (375 bp) acts as an internal control forthe reaction.
Polymerase chain reaction determined the GSTM1 genotype. In a 20 μL PCR reaction mixture comprising 100 ng of DNA and 0.8 μM of primers for GSTM1(F5’-GAACTCCTGAAAGCTAAGC-3,’R5’-GAAGCCAAGGACGTAC-3’) and 0.5μM primers (’F5’-GCCCTCTGCTAACAAGTCCTAC-3,’R5’GCCCTAAAAAAGAAATC-3) for the albumin gene and 12 µL EmeraldAmp GT PCR Master Mix (2X Premix)(Takara Bio, Japan). The amplification conditions were denaturation at 98°C for 10 s followed by 35 cycles of annealing at 64°C for 45 s, and extension at 72°C for 1 min (Thermocycler Bio-Rad, USA). Amplified PCR products were resolved on a 1.5 % agarose gel stained with ethidium bromide (EtBr). After electrophoresis, GSTM1 (+/+) Fuc. genotype was characterized by two bands of 215 bp and 375 bp, while only 375 bp showed GSTM1 (-/-) null genotype (Supplementary Fig.1b). The Albumin gene (375 bp) acts as an internal control for the reactions.
The GSTP1 gene in exon-5 contains the Ile105Val substitution genotypic variants by RFLP. The PCR reaction mixture in 20 μL contained 0.5 μM of each primer (F5’- ACCCCAGGGCTCTATGGGAA-3’R5’ TGAGGGCACAAGAAGCCCCT -3’), and 12 µL EmeraldAmp GT PCR Master Mix (2X Premix)(Takara Bio, Japan) and 100 ng DNA. The amplification conditions were denaturation at 98°C for 10 s followed by 35 cycles of annealing at 60°C for 1 min and extension at 72°C for 1 min (Thermocycler Bio-Rad, USA). Amplified PCR products were digested with 6 units of the Alw261 (BsmA1) restriction enzyme (Thermo Fisher Scientific, USA) for 10 h at 37°C. The digested PCR products were analyzed using 3.5% agarose stained with ethidium bromide (EtBr). The banding pattern was as follows: wild genotype Ile/Ile (AA): 176 bp; heterozygous genotype Ile/Val(AG): 176 bp, 91 bp, and 85 bp; and homozygous mutant Val/Val (GG): 91 bp and 85 bp) (Supplementary Fig.1c).
All genotyping of 10% random samples was performed repeatedly to confirm the reproducibility of the findings and was 98%.
Expression of P53 by immunohistochemistry
Immunohistochemistry (IHC) protocol for P53 expression was performed using the BenchMark XT platform (Roche, Switzerland). Briefly, formalin-fixed- paraffin-embedded (FFPE) tissues were sectioned into 3-4μm sections using a microtome (Leica, Germany). The slides were subjected to heat treatment in Ventana CC1 retrieval solution for 30 min and then incubated with the primary antibody (Dako clone DO-7, Denmark) for 30 min. The immune complexes were detected using ultraview 3,3-diaminobenzidine (DAB) as the chromogen (Ventana). Positive and negative controls were used in each batch (Fig.2). The IHC slides were evaluated for the percentage (%) of stained cells and staining intensity. Cells expressing P53 immunostaining were assessed by nuclear staining at 20X magnification. A tumor was recorded as positive if >50% of tumor cells with 2+ and 3+ intensity were considered as mutant type P53 expression and staining of <50% cells with 1+ and 2+ intensity as wild type P53 expression [13].
DNA damage analysis by comet assay/ single-cell gel electrophoresis (SCGE)
Lymphocytes were separated using HISTOPAQUE-1077 from 03 ml of peripheral heparinized blood from untreated cases. Lymphocytes were washed and re-suspended in PBS and adjusted to 1000000 cells/mL
The comet assay was employed for DNA damage analysis as previously described Singh et al.[14] with slight modifications. Briefly, 30 μL PBS suspended cells (40000 cells) were stretched onto an 80 μL high melting point agarose (HMPA) pre-coated microscope slide. An 80 μL low melting point agarose ([LMPA) was poured onto slides and left at 4ºC to solidify. Slides were placed in a lysis buffer for one h then placed in an alkaline solution for 20 min. Electrophoresis was applied for 30 min at 4ºC, after which the slides were neutralized in 5% acetic acid and stained with ethidium bromide (EtBr). Cells were scored using an image analysis system (Komet-5.0; Kinetic Imaging, Liverpool UK) connected to a fluorescent microscope (DMLB, Leica, Germany). Approximately 100 cells/slide were analyzed. The DNA lesions in the cells were quantified as a percentage (%) of tail DNA (100% head DNA) (Fig.3a, b, c and d).
Statistical Analysis
The frequency distributions of gender, smoking status, genotypes, age and pack-years in subgroup groups; Chi-square (χ2) and t-test were used to compare variables. To assess the risk of LUAD risk ratio (RRs) along with 95% confidence intervals (95% CIs) were calculated to determine the association with specific genotypes, and P53 immunoexpression using Graph Pad Instat Version 3.05 and SPSS(IBM, USA). DNA damage was expressed as mean ± standard deviation (SD). All p values were two-tailed, and p<0.05 were considered statistically significant.