1.1. Collection sites
Mauritania is a large country in West Africa with mostly desert-covered landscape of the Sahara, and a low population density. Samples were collected in the surrounding region of the capital Nouakchott and the town of Rosso. Camels were sampled at a livestock market with an associated slaughterhouse on the outskirts of Nouakchott. In addition, one cattle herd was sampled at a dairy farm 60 km east of Nouakchott near the small village Idini (Trarza). Two other sampling sites for cattle and camels, respectively, were located in the surrounding area of Rosso (Trarza) in southwestern Mauritania. The distance between Nouakchott and Rosso is about 160 km (Fig.).
1.2. Collection of samples
Up to 30 Hyalomma ticks were collected per animal from a total of 28 camels and 63 cattle from the four aforementioned herds. Moreover, blood samples were taken from most of these animals (Idini, cattle: n= 49; Nouakchott slaughterhouse, camels: n= 13; Rosso, camels: n=15). No blood samples were available from the cattle herd in Rosso. In total, 77 blood samples were collected among the different herds. Since Hyalomma ticks are considered the main vector and reservoir for CCHFV, ticks from other genera were excluded from this study. The collected ticks were stored at -80°C at the Office National de Recherche et de Développement de l'Elevage (ONARDEL) in Nouakchott. Ethanol (90 %) was added to the samples prior to their shipment to the Friedrich-Loeffler-Institut (FLI), Germany.
1.3. Morphological and molecular tick species identification
All ticks were morphologically identified using the identification keys of Apanaskevich et al. [14-16]. Individual ticks were homogenized in AVL buffer (Qiagen, Hilden, Germany) using a Tissuelyser II (Qiagen, Hilden, Germany) machine. The homogenates were cleared by centrifugation and supernatants were used for nucleic acid extraction. DNA/RNA was extracted using a a KingFisher Flex instrument (ThermoFisher, Waltham, USA) with the NucleoMag® VET kit (Macherey-Nagel, Düren, Germany) according to the manufacturer`s protocol. A selected number of ticks that were hard to determine as well as CCHFV-positive specimens were identified using partial cytochrome oxidase 1 (CO1) gene Sanger sequencing and restriction fragment length polymorphism method (RFLP) [17].
1.4. CCHFV genome detection
RNA extracted using KingFisher instrument (ThermoFisher Scientifc, Waltham, USA) alongside the NucleoMag Vet kit (Machery-Nagel, Düren, Germany) from individual ticks and serum samples was used to screen for CCHFV. The screening was performed using a one-step real-time reverse-transcriptase PCR assay (RT-qPCR) as described previously [18]. The assay targets a conserved region within the S-Segment. Samples were considered positive in case of ct-values below 35 and weak-positive if between 35 and 40.
1.5. Molecular and phylogenetic analyses of CCHFV genotypes
In order to get a first insight into the detected CCHFV genotypes, amplicons (127 bp) of the RT-qPCR products of all positively tested samples were sequenced by Sanger sequencing (Eurofins, Luxembourg, Luxembourg) and aligned with GeneBank entries by using the BLAST tool (NCBI, Bethesda, USA). For this purpose, the PCR protocol was performed using only one primer pair specific for the African CCHFV lineage III. Due to the small length of the PCR product, it was necessary to amplify a larger segment from the S-segment, which allows a more meaningful phylogenetic analysis. Therefore, complimentary primers close to the terminal regions were selected based on the most related sequence in the BLAST results. The primers to amplify African linage 1 were: “for 5’- AACACGTGCCGCTTACGC” and “rev 5’ – TATCGTTGCCGCACAGCC”; and for African linage 3, “for 5’ – ATGGAAAACAAAATCGAGGTGAATAACAAAGAT” and “rev 5’ – TTAGATAATGTTAGCACTGGTGGCATT”. Both the reverse transcription using SuperScript IV Reverse Transcriptase (ThermoFisher, Waltham, USA) with the reverse primer as well as the PCR using the KAPA HiFi HotStart ReadyMix PCR Kit (Roche, Basel, Switzerland) were performed according to the manufacturer's instructions. The amplified fragment was sequenced by Sanger sequencing (Eurofins, Luxembourg, Luxembourg) and used to create a phylogenetic tree.
1.6. Statistical analysis
Statistical analyses included 95 % confidence intervals (CI), Fisher's exact test and Chi-square test. Therefore, R software and R-Studio (an integrated development interface for R) were used for the calculation [19]. Those ticks that could not be species identified were excluded for the Fisher's exact test and Chi-square test.