Experimental birds
Day old Vanaraja chicks (n = 320) hatched from hatchery of ICAR-Directorate of Poultry Research, Hyderabad were used in the present study. Chicks were housed, fed with standard nutrition and provided ad libitum water. All the experiments were carried out following ethical guidelines and approved by Institute animal ethics committee (IAEC/DPR/2017/7). All the chicks received HVT vaccine for Marek’s disease at day-old and LaSota vaccine for ND at 5th and 28th day through intranasal route at recommended dose.
IBD vaccines and TLR3 agonist
Commercially available vaccines viz., intermediate, intermediate plus (Venky’s India Pvt. Ltd., India) and Bursaplex (Zoetis India Pvt Ltd., India) IBD vaccines were procured and used. TLR3 agonist, Poly I:C (Sigma, MO, USA) dissolved in sterile nuclease free water was used in the study.
Immunization trial
One-day old vanaraja chicks were randomly divided into eight groups of 40 chicks each and immunized as follows. Bursaplex and poly I:C adjuvanted (10 µg/ chick) with Bursaplex vaccine were given by subcutaneous route (s/c) at day old. Other vaccines viz., intermediate, intermediate plus and poly I:C adjuvants of respective vaccines were given on 10th day of age and booster dose on 16th day of age. Intermediate and intermediate plus vaccine were given by oral route either alone or in combination with Poly I:C by intramuscular route (10 µg/ chick). Poly I:C control group received only Poly I:C by intramuscular route. Unimmunized control received only sterile PBS by i/m route (Table 1). All the vaccines were given at recommended dose as per the manufacturer’s instruction.
Table 1
Immunization plan in the experimental birds
Groups
|
Primea
|
Poly I:Cb (10µg/ bird)
|
Boosterc
|
I: Int IBD
|
+
|
-
|
+
|
II: Int IBD plus
|
+
|
-
|
+
|
III: Bursaplex
|
+*
|
-
|
-
|
IV: Int IBD + Poly IC
|
+
|
+
|
+
|
V: Int IBD plus + Poly IC
|
+
|
+
|
+
|
VI: Bursaplex + Poly IC
|
+*
|
+
|
-
|
VII: Only Poly IC
|
+
|
+
|
-
|
VIII: Unimmunized control
|
-
|
-
|
-
|
+*: Immunization at day-old by i/m route; a: prime dose at 10th day of age; b: Poly I:C given by i/m route; c: booster dose on 16th day of age |
Evaluation of humoral immune response
Blood samples from different groups of immunization trial (n = 6 /each group) were collected at weekly interval, serum separated and stored at -20ºC until further analysis. IBD specific serum antibody response from serum samples were analyzed by indirect ELISA (IDEXX laboratories, USA) by following manufacturer’s instruction. Briefly, the test was performed on 96-well ELISA plate precoated with IBDV antigen. Diluted (1:500) test sera were dispended (100 µl/well) in duplicates. Undiluted positive and negative controls (each 100 µl/well) provided along with the kit were also dispended on the coated wells. After incubating for 30 min at 25ºC, the plates were washed with distilled water to remove any unbound material and followed by the addition of 100 µl conjugate. After 30 min at 25ºC, the unbound conjugate was washed away and TMB substrate (100 µl) was added. The subsequent color developed was measured by spectrophotometer at 650 nm and corresponding OD values were recorded. The respective antibody titers were calculated as given below:
Titer = Antilog [1.09 (log10 S/P)] + 3.36
Wherein S/P = [Mean OD of test sample-Mean OD of negative control] / [Mean OD of positive control- Mean OD of negative control]
The OD values were converted into titers using their software (xChekPlus, IDEXX). The titer greater than 396 is considered positive.
ND specific antibodies were also analyzed in the serum samples by haemagglutination inhibition (HI) test using 1% chicken RBCs according to OIE protocol. The HI titre was determined as the highest dilution of serum samples that inhibited NDV agglutination of chicken RBCs.
Body weight gain, Bura bodyweight ratio and bursal lesion scoring
Body weight of three randomly selected birds from each group was recorded at weekly interval (7, 14, 21, 28, 35 & 42 D). The mean difference in body weight of different group birds (n = 3) at 7th day and 42nd day of age was calculated as body weight gain during immunization trial. Three birds from each group were humanely sacrificed at weekly interval; bursa tissue was collected and weighed. Bursa to body weight ratio (B:BW) was calculated as: bursa of Fabricius weight (g) / Body weight (g) x 1000. Bursa tissue from different groups collected on 21st day was subjected to histopathological lesion scoring. The scoring was performed as per Muskett et al. (1979) using following scale: No damage (0); mild necrosis (1); moderate and generalized lymphoid depletion (2); severe lymphoid depletion (3); atrophy of follicles and fibroplasia (4).
RNA extraction and cDNA synthesis
Spleen tissue from different groups of experimental birds were collected aseptically after humane sacrifice at 14th day of age (n = 3 /each group). Total RNA was extracted by using TRIzol (Invitrogen, CA) according to the manufacturer’s protocol and treated with DNAse I (MBI Fermentas, USA) to remove traces of genomic DNA. Subsequently, 5 ng of purified RNA was reverse transcribed to cDNA using Superscript II first strand cDNA synthesis kit (Invitrogen, CA).
Real time PCR quantification (qRT-PCR) of IL-1β and IFN-γ cytokine mRNA levels
Cytokine mRNA expression levels of IL-1β and IFN-γ were analyzed by real -time PCR using Maxima SYBR Green qPCR kit (MBI Fermentas, USA) in diluted cDNA samples using Insta Q96™ real time PCR machine (Himedia, India). The guidelines of MIQE were followed. Primer sequences were given in Table 2. Briefly, each reaction involved a pre-incubation step at 94ºC for 30s, followed by 40 cycles of 95ºC for 30 s, 55ºC for 30 s and extension at 72ºC for 30 s. Subsequently melting curve analysis was performed to check the specific product. Each sample was run in triplicate with no template control (NTC). β actin was used as housekeeping gene for normalizing the expression data.
Table 2
Gene
|
Forward Primer (5ʹ-3ʹ)
|
Reverse Primer (5ʹ-3ʹ)
|
Amplicon size (bp)
|
Reference
|
IL-1β
|
GGATTCTGAGCACACCACAGT
|
TCTGGTTGATGTCGAAGATGTC
|
272
|
Nang et al. (2011)
|
IFN-γ
|
TGAGCCAGATTGTTTCGATG
|
CTTGGCCAGGTCCATGATA
|
152
|
Nang et al. (2011)
|
β-actin
|
CCGTAAGGACCTGTACGCCAACAC
|
GCTGATCCACATCTGCTGGAAGG
|
208
|
Fan et al. (2013)
|
Statistical analysis
Humoral immune response data including IBD and ND titers were analyzed by one-way ANOVA with Tukey’s post-hoc test to analyze the difference between mean titre between groups at different time intervals. Mean titers were considered significantly different when P ≤ 0.05. Statistical analysis was performed using SPSS v. 14. Body weight gain, bursa to body weight ratio and bursal lesion scores were also analyzed by one-way ANOVA for any significant differences between groups. Expression levels of IL-1β and IFN-γ mRNA were calculated after normalizing with housekeeping gene and fold-changes in gene expressions were calculated as 2−ΔΔ Ct (Livak and Schmittgen 2001). Comparison of fold changes in gene expression between groups were performed using General Linear Model in version 9.2 of SAS software with a P value < 0.05 considered significant.