Generation of biotin-tagged XAB2 animals. To generate the targeting vector for the insertion/knock-in of the Avi tag cassette before the stop codon of the last exon of the XAB2 gene for the generation of the avXAB2 knock-in mice, PCR products were first amplified using Phusion High- Fidelity DNA Polymerase (NEB). The avi-tag was sub cloned in pBSSK (EcoRI/Hind III 0.18- kb). A triple ligation reaction was set up using the fragments: 5’ homology sub cloned in two fragments (XbaI/BamHI 2.4kb and BamHI/ExoRI 1.2kb); avi tag (EcoRI/Hind III 0.18- kb); pBSSK-avi tag (XbaI/ExoRI 2.9kb). The lox-neomycin-lox cassette (HindIII/SalI 1.5-kb) was subsequently cloned into the vector followed by cloning of the 3’ homology region (SalI fragment 3.3kb). Finally, the MC1-TK gene (SacII 1.8-kb) was inserted into the vector for negative selection. The final targeting vector was linearized using NotI and used for embryonic stem cell electroporation. 129/SV embryonic stem cells carrying the Protamine 1-Cre transgene were maintained in their undifferentiated state (LIF-ESGRO 107 units) and grown on a feeder layer of gamma-irradiated (3.500 rads) G418r primary mouse embryonic fibroblasts. Electroporation (400V, 25μF) of 0.8x107 embryonic stem cells with 50μg of NotI linearized targeting vector (2mg mL-1) was performed and homologous recombined clones were selected with G418 (300μg mL-1) and ganciclovir (2μM). G418-resistant embryonic stem cell clones were subjected to Southern blot analysis and hybridized with 5’ and 3’ probes from their homology region. Genomic DNA from embryonic stem cell clones was digested overnight with EcoRV (MINOTECH Biotechnology) and resolved on 1% agarose gels. Samples were immobilized on Hybond-NC nylon membranes (Amersham Bioscience) and hybridized with probes with [32P] dCTP (Izotop). 5’ (1.1kb NcoI/EcoRI) and 3’ (1.2-kb BglII/Hind III) specific probes flanking the last exon of the Xab2 gene were used to identify the targeted (6.4-kb or 7.5-kb) and wild-type allele (15.8-kb). Clones with the correct homologous recombination were expanded to confirm their integrity and karyotyped to verify their euploid karyotype. Positive clones tested negative for mycoplasma (Venor GeM) were used for C57/BL6 blastocyst injection to generate chimeric mice. Chimeric males were bred to C57BL/6 wild-type females for germline transmission. Offspring were screened by PCR for neo-deletion using primers F1: 5’-AAGAACTGTCGCTCCCTGATGAAC-3’ and R1 5’-CCTGGGGGGAAAGAATGAATTGCT-3’ (Fig. 1a). Expression of Protamine-1 Cre transgene in the male germ line resulted in the deletion of the floxed neomycin gene in all the first pups born, leaving behind a single loxP site after the avi tag cassette. The Cre recombinase transgene, derived from the PC3 embryonic stem cell background, was bred out in the process of backcrossing to C57BL/6 mice. Biotin-tag XAB2 knock-in mice were further crossed to transgenic BirA transgenic mice 27. Mice were kept on a regular diet and housed at the IMBB animal house, which operates in compliance with the `Animal Welfare Act' of the Greek government, using the `Guide for the Care and Use of Laboratory Animals' as its standard. As required by Greek law, formal permission to generate and use genetically modified animals was obtained from the responsible local and national authorities. The independent Animal Ethical Committee at FORTH approved all animal studies.
Mass Spectrometry studies. Proteins eluted from the beads were separated by SDS/PAGE electrophoresis on an 10% polyacrylamide gel and stained with Colloidal blue silver (ThermoFisher Scientific, USA; 74. SDS-PAGE gel lanes were cut into 2-mm slices and subjected to in-gel reduction with dithiothreitol, alkylation with iodoacetamide and digested with trypsin (sequencing grade; Promega), as described previously 75,76. Nanoflow liquid chromatography tandem mass spectrometry (nLC-MS/MS) was performed on an EASY-nLC coupled to an Orbitrap Fusion Tribid mass spectrometer (Thermo) operating in positive mode. Peptides were separated on a ReproSil-C18 reversed-phase column (Dr. Maisch; 15 cm × 50μm) using a linear gradient of 0–80% acetonitrile (in 0.1% formic acid) during 90 min at a rate of 200 nl/min. The elution was directly sprayed into the electrospray ionization (ESI) source of the mass spectrometer. Spectra were acquired in continuum mode; fragmentation of the peptides was performed in data-dependent mode by HCD. Raw mass spectrometry data were analyzed with the MaxQuant software suite 77 (version 1.6.0.16) as described previously 76 with the additional options ‘LFQ’ and ‘iBAQ’ selected. The A false discovery rate of 0.01 for proteins and peptides and a minimum peptide length of seven amino acids were set. The Andromeda search engine was used to search the MS/MS spectra against the Uniprot database (taxonomy: Mus musculus, release September 2017), concatenated with the reversed versions of all sequences. A maximum of two missed cleavages was allowed. The peptide tolerance was set to 10 ppm and the fragment ion tolerance was set to 0.6Da for HCD spectra. The enzyme specificity was set to trypsin and cysteine carbamidomethylation was set as a fixed modification. Both the PSM and protein FDR were set to 0.01. In case the identified peptides of two proteins were the same or the identified peptides of one protein included all peptides of another protein, these proteins were combined by MaxQuant and reported as one protein group. The generated ‘proteingroups.txt’ table was filtered for contaminants and reverse hits. For interactor identification, t-test-based statistics was applied on LFQ. First, the logarithm (log 2) of the LFQ values were taken, resulting in a Gaussian distribution of the data. This allowed imputation of missing values by normal distribution (width=0.3, shift=1.8), assuming these proteins were close to the detection limit. Statistical outliers for the XAB2 samples compared to BirA control were then determined using two-tailed t-test. Multiple testing correction was applied by using a permutation-based false discovery rate (FDR) method in Perseus.
Cells, colony formation and unscheduled DNA synthesis assays. Mouse embryonic stem cells JM8A3N.1 were cultured on gelatinized tissue culture dishes in medium containing Dulbecco's modified Eagle's medium (DMEM) supplemented with 15% fetal bovine serum (FBS), 50μg mL-1 streptomycin, 50 U mL-1 penicillin (Gibco), 2mM L-glutamine (Gibco), 1% non-essential amino acids (Gibco), 0.1mM β-Mercaptoethanol (Applichem), 1μM MEK inhibitor PD0325901 (Selleck), 3μM GSK inhibitor CHIR99021 (Selleck). Primary MEFs (P4) and HEPA cells were cultured in standard medium containing Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 50μg mL-1 streptomycin, 50 U mL-1 penicillin (Gibco), 2mM L-glutamine (Gibco). Serum starved MEFs were grown in DMEM supplemented with 1% FBS for 24hrs before treatments. To knockdown Xab2 an oligo RNA was designed at the position 1685 (si1) and at position 1460 (si2) of the cDNA (Invitrogen). Mouse embryonic stem cells were transfected in suspension with Lipofectamine 2000 (Invitrogen) and subsequently plated in a 60mm plate. HEPA cells were transfected with Polyplus Jet prime according to the manufacturer’s protocol. As a non-targeting control, AllStars negative (Qiagen) was used. MEFs were transfected with Amaxa Mouse Embryonic Fibroblast Nucleofector Kit. Both siRNAs were used at a final concentration of 50nM. MEFs were protein transfected with recombinant RNase H (NEB) using Project Reagent Transfection Kit (Thermo, 89850). 5units of RNase H were used per 24well plate. Cells were transfected 1hr before tRA/tRA illudin treatments. Cells were rinsed with PBS, exposed to UVC irradiation at the indicated doses, MMC (10 μg mL-1) (AppliChem), tRA (10 μM) (Sigma-Aldrich), illudin S (50ngr/ml), isoginketin (30-60μΜ) and cultured at 37oC for 4 to 12h prior to subsequent experiments. Pre-incubation with isoginketin (30-60μΜ), ATM inhibitor (10 μM) and ATR inhibitor (10μM), started 6hrs (isoginketin) or 1 h (ATM, ATR inhibitors) before UVC irradiation and lasted throughout the experiment. For cell survival experiments, a total of 200-300 HEPA cells 24h post knock-down or primary MEFs or were seeded in 10 cm Petri dishes. The next day, MEFs were exposed to MMC treatment for 4 h or to UVC irradiation and incubated for 10 days. Colonies were stained with Coomassie blue (0.2% Coomassie blue, 50% methanol, 7% acetic acid), and the number of colonies was counted and expressed as a percentage of the treated cells relative to that of the untreated control. Three dishes per dose were used and at least three independent survival experiments were performed. For viability experiments, Trypan blue inclusion was used at selected time points post transfection. Culture medium was collected and centrifuged to precipitate dead cells. HEPA cells were detached from the tissue culture dish by trypsin-0.5% EDTA, resuspended in culture medium and merged with the fraction of cells from the medium. The cell suspension was subsequently diluted 1:5 with 0.4% Trypan blue and the number of viable and dead cells was counted in a Neubauer haemocytometer under the microscope. The number of viable cells was expressed as the percentage of viable cells relative to that of the control cells. At least three independent viability experiments per time point were performed. DNA repair synthesis was determined by 5-ethynyl-2’-deoxyuridine (EdU) incorporation. Primary MEFs grown on coverslips were globally UVC irradiated and incubated for 2.5 h in medium supplemented with 10 mM EdU. After EdU incorporation, cells were washed with PBS followed by fixation with 2% formaldehyde in PBS. Coverslips were blocked for 30 min with 10% FBS in PBS, followed by 1 h incubation with 10mM sodium ascorbate and 4mM CuSO4 containing Alexa Fluor594 azide (ThermoFischer Scientific A10270) and DAPI staining. The number of EdU-positive cells among at least 200 cells was counted, and the percentage of EdU-positive cells relative to the total number of cells was calculated. DNA transcription sites were labelled as follows. MEFs were grown on coverslips. After treatments cells were washed with ice-cold TBS buffer (10mMTris-HCl, 150mMNaCl, 5mMMgCl2) and further washed with glycerol buffer (20mMTris-HCl, 25%glycerol, 5mMMgCl2, 0,5mMEGTA) for 10min on ice. Washed cells were permeabilised with 0,5% TritonX-100 in glycerol buffer (with 25U/ml RNase inhibitor) on ice for 3min and immediately incubated at RT for 30min with nucleic acid synthesis buffer (50mMTris-HCl pH7.4, 10mM MgCl2, 150mM NaCl, 25%glycerol, 25U/ml RNase inhibitor, protease inhibitors, supplemented with 0,5mM ATP,CTP,GTP and 0,2mMBrUTP. After incorporation, cells were fixed with 4% formaldehyde in PBS on ice for 10min. Immunofluorescence with a-BrdU antibody was performed as described below.
Immunofluorescence, Antibodies, Westerns blots and FACS. Immunofluorescence experiments were performed as previously described 27,58. Briefly, cells were fixed in 4% formaldehyde, permeabilized with 0.5% Triton-X and blocked with 1% BSA. After one-hour incubation with primary antibodies, secondary fluorescent antibodies were added and DAPI was used for nuclear counterstaining. Samples were imaged with SP8 confocal microscope (Leica). For local DNA damage infliction, cells were UV-irradiated (60 J m-2) through isopore polycarbonate membranes containing 3-μm-diameter pores (Millipore). For CPD immunodetection, nuclear DNA was denatured with 1M HCl for 30min. For S9.6 immunofluorescence cells were fixed with ice-cold methanol at -200C for 10min.RNase H treatment was performed post-fixation at 370C in PBS supplemented with 10-15 Units RNaseH for 30min. For whole cell extract preparations, cell pellets were resuspended in 150mM NaCl, 50mM Tris pH=7.5, 5% Glycerol, 1% NP-40, 1mM MgCl) and incubated on ice for 30 min. For cell cycle analysis cells were fixed with 70% ethanol for 30min, washed with PBS, RNase A treated (1mgr/ml) at 370C for 30min and stained with propidium iodide (RT,20mgr/ml) for 1hrs. Antibodies against XAB2 (wb: 1:2000, IF: 1:1000), PRP19 (wb: 1:1000, IF: 1:500), β-TUB (wb: 1:2000) were from Abcam. BCAS2 (wb: 1:5000, IF: 1:1000), DDB1 (IF: 1:500) were from Novus. HA (Y-11, western blotting (wb): 1:500), ERCC1 (D-10, wb: 1:500), RAD9A (wb: 1:300), POLII (wb: 1:500, IF: 1:50), XPA (wb: 1:500), XPF (F-11, wb: 1:500) and XPG (sc12558, wb: 1:200) were from Santa Cruz Biotechnology. γH2Ax (05-636, IF: 1:12.000) and S9.6 (MABE1095, IF: 1:300) was from Millipore. DDB1 (wb: 1:5000), XPC (wb: 1:1000) and CSB (wb: 1:1000) were from Bethyl Laboratories. Streptavidin-HRP (wb: 1:12,000) was from Upstate Biotechnology. FLAGM2 (F3165, wb 1:2.000) was from Sigma-Aldrich. CPD (IF: 1:50) was Cosmo Bio Ltd (TDM2). BrdU (1:300, IF) was from BD Pharmingen.
Co-immunoprecipitation assays. Nuclear protein extracts from 15-day-old livers or cells were prepared as previously described 27 using the high-salt extraction method (10mM HEPES-KOH pH 7.9, 380mM KCl, 3mM MgCl2, 0.2mM EDTA, 20% glycerol and protease inhibitors). For immunoprecipitation (IP) assays, nuclear lysates were diluted threefold by adding ice-cold HENG buffer (10mM HEPES-KOH pH 7.9, 1.5mM MgCl2, 0.25mM EDTA, 20% glycerol) and precipitated with antibodies overnight at 4oC followed by incubation for 2 h with protein G Sepharose beads (Millipore). Normal mouse or rabbit IgG (Santa Cruz) was used as a negative control. Immunoprecipitates were washed five times (10mM HEPES-KOH pH7.9, 300mM KCl, 0.3% NP40, 1.5mM MgCl2, 0.25mM EDTA, 20% glycerol and protease inhibitors), eluted and resolved on 10% SDS-PAGE. Pulldowns were performed with 0.6-0.7mg of nuclear extracts using M-280 paramagnetic streptavidin beads (Invitrogen) as previously described23.
Differential alternative splicing analysis. Global quality of FASTQ files with raw RNA-seq reads was analyzed using fastqc v.0.11.5 (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Vast-tools 78,79 aligning and read processing software was used for quantification of alternative sequence inclusion levels from FASTQ files using VASTD-DB annotation 80 for mouse genome assembly mm9. To ensure sufficient read coverage for alternative splicing quantification, we considered only vast-tools’ events with a minimum mapability-corrected read coverage score of “VLOW” across all samples. The relative inclusion of an alternative sequence (exon or intron), henceforth called alternative splicing event, is based on the number of junction reads supporting inclusion (#inc) and exclusion (#exc), used to quantify percent spliced-in (PSI) 81 values. The beta distribution (conjugate prior probability distribution for the binomial), constrained in the ]0,1[ interval and characterized by a mean value of / ( ) from the distribution’s shape parameters and , was exploited in modelling the precision of each PSI from its supporting coverage (#inc and #exc). We used R function rbeta to emit, for each sample, 500 values from a beta distribution with and , where 1 is added to ensure that both the shape parameters, and , are different from zero. Since beta distributions get narrower with increasing shape parameters (for the same PSI value), this parametrization allows the scattering of emitted values to serve as a surrogate for that PSI’s dispersion (given the original read coverage supporting it), while the distribution’s mean value, / ( + 1), is an approximation of the empirical PSI. For each event, rbeta-emitted values were grouped per condition (Control and Xab2 siRNA) and the median of all emitted values per group was used to determine global PSIs per condition and the difference between these, PSI = PSIXab2 siRNA - PSIControl. For each alternative splicing event, the beta distribution’s emitted values were used in calculating the significance of its PSI. First, the difference between randomly ordered Xab2 siRNA and Control vectors of emitted values was calculated. The significance of each PSI was set as the ratio between the number of differences that are greater than zero and the total number of differences, reflecting the probability of PSIXab2 siRNA being greater than PSIControl. Differentially spliced events were considered as those with a probability of a | PSI| > 0 greater than 0.8 and an absolute PSI greater than 5% (Table EV3). To assess the enrichment of differentially spliced events in positive or negative PSI values within exon skipping and intron retention events, we tested the null hypothesis that the proportion of positive PSI values (i.e. PSIXab2 siRNA > PSIControl) was equal to 0.5 using R function prop.test.
RNA immunoprecipitation studies. RNA immunoprecipitation in HEPA cells and MEFs was performed as previously described 82 with a few modifications. In brief, cells (4x150mm plate) were harvested by trypsinization and the cell pellet was resuspended in NP-40 lysis buffer for 10min on ice. Nuclei were washed once in NP-40 Lysis buffer and subsequently resuspended in 1 ml RIP buffer (150mM KCl, 25mM Tris pH 7.4, 5mM EDTA, 0.5mM DTT, 0.5% NP40, 1mM PMSF, 40U/mL RNaseOut; Invitrogen). Resuspended nuclei were mechanically sheared using a syringe (26G) with 5-7 strokes. Nuclear membranes and debris were pelleted by centrifugation at 13,000 RPM for 10 min. Antibodies (5μg) were added to supernatant and incubated overnight at 4oC with gentle rotation. Fifty microliters of protein G Sepharose beads (Millipore) were added and incubated for 2hr at 4oC with gentle rotation. Beads were pelleted at 6.000 RPM for 3 min, the supernatant was removed, and beads were washed three times in 1 mL wash buffer (280mM KCl, 25mM Tris pH 7.4, 5mM EDTA, 0.5mM DTT, 0.5% NP40, 1mM PMSF, 40 U/mL RNaseOut; Invitrogen) for 10min at 4oC, followed by one wash in PBS. Beads were resuspended in 1 ml of Trizol and co-precipitated RNAs were isolated according to the manufacturer’s protocol. RNA was precipitated with Ethanol/Sodium acetate in the presence of Glycoblue at -20oC overnight. Isolated RNA was treated with DNase I (Promega) followed by reverse transcription with random primers (Invitrogen). For RNA immunoprecipitation in liver tissue, livers from two P15 mice were minced and subsequently cross-linked with 0.1% formaldehyde for 10 min at room temperature. After addition of 0.25 M glycine for 5 min, cells were harvested and lysed with RIPA buffer (50mM Tris-HCl [pH 7.4], 1% NP-40, 0.5% Na deoxycholate, 0.05% SDS, 1mM EDTA, and 150mM NaCl) followed by sonication at 4°C. Nuclear membrane and debris were pelleted by centrifugation at 13,000 RPM for 10 min. Antibodies (5μg) were added to supernatant and incubated overnight at 4oC with gentle rotation. Fifty microliters of protein G Sepharose beads (Millipore) were added and incubated for 2 hours at 4oC with gentle rotation. Beads were pelleted at 6.000 RPM for 3 min, the supernatant was removed, and beads were washed three times in 1 mL wash buffer (50mM Tris-HCl [pH 7.4], 1% NP-40, 0.5% Na deoxycholate, 0.05% SDS, 1mM EDTA, and 350mM NaCl) for 10min at 4oC, followed by one wash with PBS. Crosslinks were reversed by adding 100μl elution buffer (50mM Tris-HCl pH 6.5, 5mM EDTA, 1% SDS, and 10mM DTT) and heating for 45 min at 70°C. RNA was purified with TRIzol reagent, treated with DNase I, and used for first-strand cDNA synthesis.
RNA-Seq and Quantitative PCR studies. Total RNA was isolated from cells using a Total RNA isolation kit (Qiagen) as described by the manufacturer. For RNA-Seq studies, libraries were prepared using the Illumina® TruSeq® mRNA stranded sample preparation Kit for HEPA cells and for mESCs. Library preparation started with 1µg total RNA. After poly-A selection (using poly-T oligo-attached magnetic beads), mRNA was purified and fragmented using divalent cations under elevated temperature. The RNA fragments underwent reverse transcription using random primers. This is followed by second strand cDNA synthesis with DNA polymerase I and RNase H. After end repair and A-tailing, indexing adapters were ligated. The products were then purified and amplified to create the final cDNA libraries. After library validation and quantification (Agilent 2100 Bioanalyzer), equimolar amounts of all 12 libraries were pooled. The pool was quantified by using the Peqlab KAPA Library Quantification Kit and the Applied Biosystems 7900HT Sequence Detection System. The pool was sequenced by using an Illumina HiSeq 4000 sequencer with a paired-end (2x 75 cycles) protocol. Quantitative PCR (Q-PCR) was performed with a Biorad 1000-series thermal cycler according to the instructions of the manufacturer (Biorad) as previously described 27. All relevant data and primer sequences for the genes tested by qPCR are available upon request.
DIP. DRIP analysis was based on CHIP analysis with some modifications. DIP analysis was performed without a cross-linking step. Nuclei were isolated using 0,5% NP-40 buffer. Isolated nuclei were resuspended in TE buffer supplemented with 0,5%SDS and 100mgr proteinase K. Genomic DNA was isolated after addition of KoAc (1M) and isopropanol precipitation. DNA was sonicated on ice 3 min using Covaris S220 Focused ultrasonicator. Samples were treated with RNase H (10units/5μg DNA) at 370C overnight. Samples were immunoprecipitated with S9.6 antibodies (8 μg antibody/ 5μg DNA) overnight at 4oC followed by incubation for 3 hours with protein G-Sepharose beads (Millipore) and washed sequentially. The complexes were eluted and purified DNA fragments were analyzed by qPCR using sets of primers targeting different regions of related genes.
DRIP western analysis. DRIP western analysis was performed as described previously 73. Non-crosslinked cells were lysed in 0.5% NP40 buffer for 10 min on ice. Pelleted nuclei were lysed in RSB buffer (10 mM Tris-HCl pH 7.5, 200 mM NaCl, 2.5 mM MgCl2) with 0.2% sodium deoxycholate [NaDOC, 0.1% SDS and 0.5% Triton X-100, and extracts were sonicated for 10 min (Diagenode Bioruptor). Extracts were then diluted 1:4 in RSB with 0.5% Triton X-100 (RSB + T) and subjected to IP with the S9.6 antibody (8 μg antibody/ 5μg DNA), bound to protein A dynabeads (Invitrogen), and pre-blocked with 1mg/ml BSA/PBS for 1 hr. IgG2a antibodies were used as control. RNase H (PureLink, Invitrogen) was added before IP as in DRIP. Beads were washed 4x with RSB + T; 2x with RSB; and eluted in 1x Laemmli.
Sequential native ChIP analysis. Non-cross-linked cells were lysed using 0,5% NP-40 buffer. Chromatin was digested with MNase (50 Units/0.5mgDNA) at 370C for 10min. S1 chromatin fraction was isolated. S2 chromatin fraction was dialyzed against Tris-EDTA buffer for 2hrs and isolated. S1 and S2 chromatin fractions were used for pulldown using M280 paramagnetic streptavidin beads (Invitrogen). After sequential washes complexes were eluted. A fraction of them was kept for qPCR analysis and the rest was used for S9.6 immunoprecipitation as described above.
Primer sequences: Primer: ATM (intron) Forward: TGGCTGCATCTACCTGTGAC Reverse: TGCTAGTCAGCCCTCCTCAT, Primer: ATM (exon) Forward: ACCCAGGTCTATGTGCACAA Reverse: CCCCTGTTCAAAAGCCACTC, Primer: ERCC2 (exon) Forward: GGCTGTGATCATGTTTGGAG, Reverse: CAGCAAAGACCATGAGTCCA, Primer: ERCC2 (intron) Reverse: CCCTGACAGCACTGTTTCC, Primer: U4 snRNA Forward: GCAGTGGCAGTATCGTAGCC Reverse: AAAATTGCCAATGCCGACTA, Primer: U6 snRNA Forward: CGCTTCGGCAGCACATATAC Reverse: ATGGAACGCTTCACGAATTT, Primer: Rad9 (exon) Forward: GTAGTAGCTGCTGGGACTCA Reverse: TTCGGGATAGCGAATGGACA, Primer Rad9 (intron) Forward: GGCAACGTGAAGGGTAAGTT Reverse: -CGGGGAGGAGAACAGAAAGT, Primer Ercc1 (exon) Forward: AAAGATCCCCAGCAGGCTC Reverse: ATAAGGAGGTCGGCTGGCTT, Primer Ercc1 (intron) Forward: CTAAGCCAAGCATGGTGACA Reverse: TGGGGAGAACAGAACAAACC, Primer CDK7 (exon) Forward: ACTGCAGCACATCTTCATCG Reverse: GGGGCGGTTACTGAAGTACT, Primer DDB1 (exon) Forward: CCTCGAATCCATCCTGATGAC, Reverse: AGAGCAAGCAAAGACGTTGG, Primer DDB1 (intron) Forward: CCTCGAATCCATCCTGATGAC, Reverse: AGCTGCTTGGTTAAGGCTCA, Primer H2Afz (exon) Forward: TAAAGCGTATCACCCCTCG Reverse: TCAGCGATTTGTGGATGTGT, Primer H2Afz (intron) Forward: CGTATCACCCCTCGTCACTT Reverse: ATGACATACCACCACCAGCA, Primer Rarb2 (P) Forward: GGGAGTTTTTAAGCGCTGTG Reverse: ACCACTTCTGTCACACGGAAT, Primer Rarb2 (C): Forward: ATCTCTTGAAAAAGGTGCCGAACGT Reverse: GGAAATGTCTCACTGCAGCAGTGGT, Stra6 (P) Forward: AGGCACCCTTTTAAGGAGGA Reverse: TTCCACACCTCACAAAGACG, Stra6 (C) Forward: ACCACACATACCAAAACTTCCTG Reverse: CGGGGTAAAGACGTACCTTC, ChordC (P) Forward: GCAGTCCGGTAGGAAATCTG Reverse: CCGGTACTGCTTCAGGAATTT, ChordC (C) Forward: TTCAAGCCCCTAAGCCAGTA, Reverse: TACACGAGTGGACACTGCAA
Quantification and Statistical analysis. A two-tailed t-test was used to extract the statistically significant data by means of the IBM SPSS Statistics 19 (IBM) and the R software for statistical computing (www.r-project.org). Significant over-representation of pathways and gene networks was determined by Gene Ontology (http://geneontology.org/). Data analysis is discussed also in the Method Details section. Experiments were repeated at least 3 times. The data exhibited normal distribution (where applicable). There was no estimation of group variation before experiments. Error bars indicate standard deviation unless stated otherwise (standard error of the mean; s.e.m.). For animal studies, each biological replicate consists of 3-5 mouse tissues or cell cultures per genotype per time point or treatment. No statistical method was used to predetermine sample size. None of the samples or animals was excluded from the experiment. The animals or the experiments were non-randomized. The investigators were not blinded to allocation during experiments and outcome assessment.
Data availability. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium (http://proteomecentral.proteomexchange.org) via the PRIDE partner repository with the dataset identifier PXD014084. The RNA-Seq data are deposited in ArrayExpress (https://www.ebi.ac.uk/arrayexpress/), (E-MTAB-8035). All other data and reagents are available from the authors upon reasonable request.