Transcriptional Regulation of Exopolysaccharide-related Genes in Lactiplantibacillus Plantarum VAL6 Under Environmental Stresses

doi:10.21203/rs.3.rs-459865/v1

Download PDF

Research Article

Transcriptional Regulation of Exopolysaccharide-related Genes in Lactiplantibacillus Plantarum VAL6 Under Environmental Stresses

https://doi.org/10.21203/rs.3.rs-459865/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 13 Jul, 2021

Read the published version in Archives of Microbiology →

You are reading this latest preprint version

Environmental factors can alter exopolysaccharide biosynthesis in LAB. To further clarify this potential relationship, the mRNA expression of exopolysaccharide-related genes such as glmU, pgmB1, cps4E, cps4F, cps4J and cps4H genes in Lactiplantibacillus plantarum VAL6 under different conditions including high temperature, acidic or alkaline pH, sodium chloride (NaCl) and carbon dioxide (CO₂) intensification culture was studied. The transcriptomic data revealed that the exposure of L. plantarum VAL6 to acid at pH 3 increased the expression level of cps4H but decreased the expression levels of pgmB1 and cps4E. Under pH 8 stress, cps4F and cps4E were significantly upregulated, whereas pgmB1 was downregulated. Similarly, the expression levels of cps4F, cps4E and cps4J increased sharply under stresses at 42 or 47^oC. In the case of NaCl stress, glmU, pgmB1, cps4J and cps4H were downregulated in exposure to NaCl at 7-10% concentrations while cps4E and cps4F were upregulated at 1 h of 10% NaCl treatment and at 5 h of 4% NaCl treatment. Remarkably, CO₂ intensification culture stimulated the expression of all tested genes. In addition, simultaneous changes in expression of cps4E and cps4F under environmental challenges may elicit the possibility of an association between the two genes. These findings indicated that the expression level of exopolysaccharide-related genes is responsible for changes in the yield and monosaccharide composition of exopolysaccharides under environmental stresses.

General Microbiology

Environmental stress

gene expression

Lactobacillus plantarum

qPCR

real-time PCR

Lactic acid bacteria (LAB) are ubiquitous appearance in food by their generally recognized as safe status (Ismail and Nampoothiri 2010). LAB are capable of producing exopolysaccharides (EPSs) which are widely used in various applications (Baruah et al. 2016). EPS production in LAB has been received a lot of attention in recent years due to the unique biological properties of these biopolymers (Silva et al. 2019). This is exemplified in Lactiplantibacillus plantarum, which is commonly utilized in the health and food areas owning to its ability to produce EPSs with specific functions (Silva et al. 2019).

In nature as well as in industrial applications, LAB are often exposed to adverse environmental conditions (Le Marrec 2011). Indeed, LAB have various adaptive mechanisms to protect themselves from environmental stresses including changes related to the expression of genes and proteins (Mbye et al. 2020), to the cell's envelope with enhanced synthesis of EPSs (Huu Thanh et al. 2014). Many studies demonstrated that environmental stresses such as high temperature (Huu Thanh et al. 2014), acidic or alkaline pH, NaCl (Nguyen et al. 2021) and CO₂ (Ninomiya et al. 2009), etc. can stimulate EPS synthesis.

In LAB, EPSs play an important role in protecting the cells from harsh environmental conditions (Nguyen et al. 2020). In addition, EPSs are also involved in the formation of biofilm and adhesion (Caggianiello et al. 2016) as well as in determining cell interaction characteristics (Lee et al. 2016). Nonetheless, the structure and biological function of EPSs may vary depending on environmental conditions (Vu et al. 2009) that related to the transcriptional levels of eps genes (Boels et al. 2003).

EPS synthesis in LAB is a complex process involved in the regulation of expression of EPS-related genes (Zeidan et al. 2017). Furthermore, changing environmental conditions can alter the expression level of these genes (Wu and Shah 2018). Therefore, in this study, we evaluated the impact of various environmental challenges on the expression levels of genes involved in EPS synthesis in L. plantarum VAL6. The overall aim of the study was to clarify the potential relationships between these regulatory systems and environmental stresses.

Bacterial strain and culture conditions

L. plantarum VAL6 was obtained from Department of Biotechnology, An Giang University, Vietnam National University Ho Chi Minh City, Vietnam. To perform microbial cell culture for this study, L. plantarum VAL6 was grown in Man–Rogosa–Sharpe medium (MRS) (De Man et al. 1960). L. plantarum VAL6 was stored at – 80°C; it was rehydrated in MRS broth with 2% (vol/vol) inoculum, followed by incubating at 37°C for 24 h, agitation rate was set up to 250 rpm under aerobic facultative condition.

Bioreactor operating conditions for stress treatments

The examination was carried out in 5-L bioreactors (BIOSTAT. Sartorius Stadium, Germany). Briefly, 5 L of MRS medium was inoculated with 100 mL of overnight bacterial culture (OD₅₉₅ = 1.5). The pH was maintained to 6.8 by regularly adding 10 M NaOH, the temperature was kept at 37^oC, and agitation rate was set up to 250 rpm. After 24 h of culture, stress treatments were then performed independently:

For thermal stress, the culture was treated with high temperature either 42 or 47°C for 7 h. The time was calculated when the bioreactor reached the required stress temperature. The pH was maintained to 6.8 and the temperature was kept at 37^oC.

For pH stress, the culture was treated with pH conditions either pH 3 or pH 8 for 7 h. The time was calculated when the bioreactor reached the required pH. The temperature was kept at 37^oC.

For NaCl stress, the culture was treated by adding NaCl to reach 4–10% concentrations for 7 h. The pH was maintained to 6.8 and the temperature was kept at 37^oC.

The non-stress control of these treatments was simultaneously carried out in another bioreactor, where the pH was maintained to 6.8, the temperature was maintained at 37^oC for the entire time.

In the case of CO₂ treatment, right after inoculation, CO₂ was continuously supplied at the rate 250 cm³/min for 4 h or 8 h. After the set time, the cultures were continued until 24 h without CO₂ supplement. The 24-hour CO₂ treatment was supplied with CO₂ (250 cm³/min) during the culture period. The non-stress control of this treatment was also carried out at the same time without CO₂ supplement.

Extraction of total RNA and synthesis of first-strand cDNA

Total RNA was extracted according to the instructions of TRIzol reagent (Invitrogen, UK). RNA was treated with RQ1 RNase-free DNase (Promega, Madison, USA) to remove contamination of chromosomal DNA. Qualitative test of RNA at 260 and 280 nm was found to be more than 1.8 using a NanoDrop DeNovix DS-11 Spectrophotometer (DeNovix, Wilmington, DE USA). The first-strand cDNA was synthesized according to the instructions of the GoScript™ Reverse Transcription System Kit (Promega, Madison, USA).

Design and synthesis of primers

The reference gene was selected from the housekeeping gene, i.e. 16S rRNA. Primers of the six target genes were designed for quantitative real-time polymerase chain reaction (qPCR) analysis based on the genome sequence of L. plantarum WCFS1 (Genbank: AL935263.2) using Primer-BLAST software (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). The primers were synthesized by The Shanghai Brilliance Biotechnology Co. Ltd.. The primers were designed with sequence length from 18–23 nucleotides, coupling temperature (T_m) from 57–60°C and GC rate not more than 70% (Table 1).

Table 1

The primers used for the amplification
Gene	Primer name	Primer sequence (5'->3')	T_m (^oC)	Product length
glmU	glmU sense	ATGCAACAACGGATCAACGC	60.1	475
	glmU antisense	CGACATTCGTGTGGTGCTTG	60.1	475
pgmB1	pgmB sense	TCGATGGCGTTATCACGGAC	60.3	423
	pgmB antisense	CGGGATCAGGTTTACCGTGT	59.8	423
cps4E	epsE sense	AGTTGACTTCTGACGGTCCC	59.3	449
	epsE antisense	AACCGTTCCCATCAGCATCT	59.4	449
cps4F	epsF sense	CTGGGGCTTTACTCCTGGTG	60	452
	epsF antisense	CCCCAACGTCCGATTGAGAA	60	452
cps4J	wzx sense	ACGGCTCGATTTTTAGGGCT	59.8	480
	wzx antisense	GACGCTCATTGCGATTGGTG	60.3	480
cps4H	wzy sense	TTTGCTTTGGTCATGCTGGC	60	596
	wzy antisense	TCGGACGTTCCGAACCAAAT	60	596
16s RNA	16s sense	GCATTAAGCATTCCGCCTGG	60	183
	16s antisense	ACCTGTATCCATGTCCCCGA	60	183

qPCR experiment

The qPCR experiment was performed on an Liberty16 mobile real time PCR system (Ubiquitome Limited, New Zealand), according to the instructions of the SensiFAST SYBR No-Rox Kit (Bioline, Meridian Bioscience, USA). The reaction mixture contained 10 µL of SensiFAST SYBR No-Rox Solution (2X), 7.4 µL of cDNA template, 0.8 µL of forward primer (10 µM), 0.8 µL of reverse primer (10 µM) and 1 µL of molecular grade water. As a negative control for all qPCR experiments, cDNA was replaced with RNA (without the reverse transcription step as template). The reaction for each gene was carried out in triplicate in individual qPCR reactions. The PCR amplification conditions were denaturation at 95°C for 3 min, followed by 40 cycles of amplification at 95°C for 30 s, 58°C for 30 s and 72°C for 30 s. Fluorescence performance was obtained at the end of each thermal cycle. The 2^−ΔΔCt method was used to calculate the relative changes in gene expression (Livak and Schmittgen 2001).

Statistical analysis

The experiments were repeated three times. All the data were expressed as means ± standard deviations. Significance of difference was evaluated with one way ANOVA, followed by Fisher’s least significant difference (LSD) procedure to identify statistically significant differences at the 95.0% confidence interval. One-way analysis of variance was performed. LSD multiple-range tests were applied to the individual variables to compare means and to assess if there was a significant difference.

The expression of EPS-related genes under thermal stress

The effect of high-temperature stresses (42 and 47^oC) on the expression of EPS-related gene in L. plantarum VAL6 was investigated via RNA sequencing. Through analysis and comparison of the gene expression profile of the stressed L. plantarum VAL6 and the control (37^oC), we found that cps4F, cps4E and cps4J genes were significantly (p < 0.05) upregulated in response to thermal stress. Also, the exposure time played an important role in the regulation of these genes (Fig. 1).

The expression level of cps4E (Fig. 1d) peaked at 5 h after thermal stress with 13.4 and 38.1-fold under 42 and 47^oC treatments, respectively. Similar to cps4E, the highest expression level at the same time of cps4F (Fig. 1c) was 27.6-fold under 42^oC treatment and 32.8-fold under 47^oC treatment. However, the expression levels of two genes decreased after exposure to thermal stress for 7 h. Meanwhile, the expression level of cps4J was steadily increased over time of stress and reached more than 18-fold after 7 h of treatment (Fig. 1e).

The expression of EPS-related genes under acid or alkaline stress

In order to survive and adapt to acid or alkaline stress, microorganisms have developed complex mechanisms at physiological and molecular levels (Guan and Liu 2020). In this work, the response of L. plantarum VAL6 to acid or alkaline stress via the transcriptional analysis of EPS-related genes was also studied. The results disclosed that cps4H was significantly (p < 0.05) upregulated in exposure to acid at pH 3. Meanwhile, cps4F and cps4E were significantly (p < 0.05) upregulated in response to alkaline stress condition (Fig. 2).

Under stress at pH 3, there was a great increase in the expression level of cps4H (~ 4-fold) (Fig. 2f), but the expression levels of glmU, pgmB1 and cps4E decreased (Fig. 2a, Fig. 2b and Fig. 2e). In the case of stress at pH 8, the expression level of cps4F increased steadily from 2-fold at 1 h to 3.3-fold at 7 h (Fig. 2c). As a similar pattern with cps4F, the expression level of cps4E was also rose gradually from 2.8 to 3.9-fold during the time of stress (Fig. 2d).

The expression of EPS-related genes under NaCl stress

The alteration in gene expression under osmotic stress is also to adjust cellular metabolisms (Le Marrec 2011). Therefore, it is important to consider transcriptional regulation in exposure to osmotic stress. In this study, we also investigated the effect of the addition of NaCl at different concentrations on the expression of genes involved in EPS synthesis in L. plantarum VAL6. The overall results indicated that the expression of glmU, pgmB1, cps4J and cps4H genes were significantly (p < 0.05) downregulated in exposure to NaCl at 7–10% concentrations (Fig. 3).

In addition, an increase in the expression level of cps4F was detected (~ 1.2-fold) at 1 h of 10%-NaCl treatment and at 5 h of 4%-NaCl treatment (Fig. 3c). Similarly, cps4E was upregulated by 1.3 and 1.4-fold at 1 h of 10%-NaCl treatment and at 5 h of 4%-NaCl treatment, respectively (Fig. 3d).

The expression of EPS-related genes under CO₂ intensification culture

Unlike other stress treatments, CO₂ intensification culture increased the expression of all tested genes between 1.2 and 3-fold. Furthermore, with the exception of cps4E, the other genes were upregulated with increasing time of CO₂ supplementation (Fig. 4). The highest expression level of cps4E was 1.8-fold upon exposure to 8-hour CO₂ treatment, while its expression returned to 1.5-fold upon exposure to 24-hour CO₂ treatment (Fig. 4d).

Changes in environmental conditions may alter extracellular polysaccharide production (Lloret et al. 1998) and induce the synthesis of new type of EPSs in bacteria (Nandal et al. 2005). In addition, the overexpression of a certain gene involved in EPS synthesis can increase or decrease the level of a specific sugar component in EPSs (Nguyen et al. 2021). Hence, based on gene expression profiles, it is possible to predict the alteration of monosaccharide composition in EPSs.

In this study, glmU was only upregulated under CO₂ intensification culture but downregulated under exposure to pH 3 and NaCl concentrations at 7–10%. In comparison with a previous study in Lactobacillus vini, glmU was also downregulated under acid stress conditions (Mendonca et al. 2019). The enzymes encoded by glmU are glucosamine-1-phosphate N-acetyltransferase converting glucosamine-1-phosphate to N-acetylglucosamine-1- phosphate and N-acetylglucosamine-1-phosphate uridyltransferase catalyzing the formation of UDP-N-acetyl-D-glucosamine from N-acetylglucosamine-1- phosphate (Li et al. 2011). UDP-N-acetyl-D-glucosamine is one of the essential precursors of the peptidoglycan structure of cell wall (Chapot-Chartier and Kulakauskas 2014) and the synthesis of repeating units of EPSs (Zeidan et al. 2017). Altogether, we could conclude that exposing L. plantarum VAL6 to CO₂ intensification culture impacts on the regulation of glmU, possibly leading to an increase in the synthesis of major component of bacterial cell wall and in the content of N-acetyl-D-glucosamine in EPSs.

The pgmB1 encodes for β-phosphoglucomutase which catalyzes the interconversion of D-glucose 6-phosphate and D-glucose 1-phosphate to form beta-D-glucose 1,6-(bis)phosphate. pgmB1 plays an important role in the formation of sugar nucleotides as UDP-glucose (Li et al. 2019). Thus, the overexpression of pgmB1 may result in increased glucose content in EPS composition. In our study, the expression of pgmB1 increased when L. plantarum VAL6 was exposed to CO₂ intensification culture but decreased in exposure to stresses at pH 3 and at 7–10% NaCl. These results were inconsistent with the study of Li et al. (2019) in L. plantarum FS5-5, pgmB expression increased in response to high salt stress (> 6%) but remained unalterably in response to low salt stress (< 6%) (Li et al. 2019). The difference in the stress method could be the cause of this discrepancy. While Li et al. supplement NaCl right after inoculation, our study stressed after culture for 24 h.

Among the upregulated genes, cps4E and cps4F encode for glycosyltransferases which transport sugar nucleotides to a lipid carrier to form repeating units (Zeidan et al. 2017). In Streptococcus thermophilus Sfi6, epsE (cps4E) encodes for a priming galactosyl-1-phosphate transferase and epsF (cps4F) encodes for a galactosyltransferase which adds the branching α-1,6-galactose (Stingele et al. 1996). In L. johnsonii FI9785, epsE (cps4E) encodes for a glycosyltransferase which adds galactose-1-phosphate to the lipid carrier (Dertli et al. 2013). In this study, with the exception of stress at pH 3, other treatment conditions could enhance the expression of these two genes. Taken together, it was suggested that EPSs isolated from L. plantarum VAL6 under environmental stress may be rich in galactose. In addition, simultaneous changes in expression of cps4E and cps4F under environmental challenges may elicit the possibility of an association between the two genes.

The cps4J encoding for flippases which are responsible for taking repeating units and transporting them across the cytoplasmic membrane (Zeidan et al. 2017) was upregulated under stresses of high temperature, and CO₂ intensification culture. Meanwhile, the overexpression of cps4H encoding for enzymes which polymerize repeating units (Zeidan et al. 2017) was detected under stress at pH 3 and CO₂ intensification culture. Thus, the enzymes encoded by cps4J and cps4H are exclusively involved in the secretion of EPSs, which demonstrated that the increase in the expression levels of two genes do not change the sugar composition of the obtained EPSs, but it was related to the resulting EPS yield.

Summary, our results revealed that different environmental conditions can alter the expression level of genes involved in EPS synthesis. Based on achieved results, we propose a profile for the changes in the expression of EPS-related genes in L. plantarum VAL6 by applying environmental challenges (Table 2). The expression of these genes may lead to changes in the monosaccharide composition of EPSs. However, it is necessary to further study the expression levels of the respective proteins in order to better understand the potential relationships between these regulatory systems and environmental stresses.

Table 2

Effects of environmental challenges on the expression of EPS-related gene
Stress	Gene^a
Stress	*glm*U	*pgm*B1	*cps*4F	*cps*4E	*cps*4J	*cps*4H
High temperature	–	–	↑	↑	↑	–
Acid pH	↓	↓	–	–	↓	↑
Alkaline pH	–	–	↑	↑	–	–
High-NaCl concentration	↓	↓	↑	↑	↓	↓
CO₂ intensification	↑	↑	↑	↑	↑	↑

^a↑ upregulation; ↓ downregulation; – non-alteration.

Acknowledgments

P.-T.N is a graduate student researcher of Graduate University of Sciences and Technology, Vietnam Academy of Science and Technology, Vietnam. The authors would like to acknowledge the Science and Technology Program for the Southwestern Sustainable Development, Vietnam National University Ho Chi Minh City for the financial support.

Funding

This study was supported by the Science and Technology Program for the Southwestern Sustainable Development, Vietnam National University Ho Chi Minh City (Project/grant number KHCN-TNB/14-19/C32), Vietnam.

Conflict of interest

The authors have no financial conflicts of interest to declare.

Author Contributions

Conceptualization, T.-S.L, P.-T.N., T.-T.N., H.-T.N.; methodology, T.-S.L, P.-T.N., T.-T.N.; investigation, T.-S.L, P.-T.N., S.-H.N.-H., T.-P.N., M.-N.T., T.-T.N.; data curation, T.-S.L, P.-T.N., T.-U.N.-T., M.-C.N., Q.-K.H., H.-T.N.; writing—original draft preparation, T.-S.L, P.-T.N., H.-T.N.; writing—review and editing, T.-S.L, P.-T.N., M.-C.N., Q.-K.H., H.-T.N.; supervision, M.-C.N., Q.-K.H., H.-T.N.; funding acquisition, H.-T.N. All authors have read and agreed to the published version of the manuscript.

Baruah R, Das D, Goyal A (2016) Heteropolysaccharides from Lactic Acid Bacteria: Current Trends and Applications. Journal of Probiotics and Health 4:2. doi:10.4172/2329-8901.1000141
Boels IC, Van Kranenburg R, Kanning MW, Chong BF, De Vos WM, Kleerebezem M (2003) Increased exopolysaccharide production in Lactococcus lactis due to increased levels of expression of the NIZO B40 eps gene cluster. Appl Environ Microbiol 69:5029-5031. doi:10.1128/aem.69.8.5029-5031.2003
Caggianiello G, Kleerebezem M, Spano G (2016) Exopolysaccharides produced by lactic acid bacteria: from health-promoting benefits to stress tolerance mechanisms. Applied Microbiology and Biotechnology 100:3877-3886. doi:10.1007/s00253-016-7471-2
Chapot-Chartier M-P, Kulakauskas S (2014) Cell wall structure and function in lactic acid bacteria. Microbial Cell Factories 13:S9. doi:10.1186/1475-2859-13-S1-S9
De Man JC, Rogosa M, Sharpe ME (1960) A medium for the cultivation of Lactobacilli. Journal of Applied Bacteriology 23:130-135. doi:10.1111/j.1365-2672.1960.tb00188.x
Dertli E, Colquhoun I, Gunning A, Bongaerts R, Le Gall G, Bonev B, Mayer M, Narbad A (2013) Structure and Biosynthesis of Two Exopolysaccharides Produced by Lactobacillus johnsonii FI9785. The Journal of biological chemistry 288. doi:10.1074/jbc.M113.507418
Guan N, Liu L (2020) Microbial response to acid stress: mechanisms and applications. Applied Microbiology and Biotechnology 104:51-65. doi:10.1007/s00253-019-10226-1
Huu Thanh N, Razafindralambo H, Blecker C, N Yapo C, Thonart P, Delvigne F (2014) Stochastic exposure to sub-lethal high temperature enhances exopolysaccharides (EPS) excretion and improves Bifidobacterium bifidum cell survival to freeze-drying. Biochemical Engineering Journal 88:85-94. doi:10.1016/j.bej.2014.04.005
Ismail B, Nampoothiri KM (2010) Production, purification and structural characterization of an exopolysaccharide produced by a probiotic Lactobacillus plantarum MTCC 9510. Archives of microbiology 192:1049-1057. doi:10.1007/s00203-010-0636-y
Le Marrec C (2011) Responses of Lactic Acid Bacteria to Osmotic Stress. In. pp 67-90. doi:10.1007/978-0-387-92771-8_4
Lee IC, Caggianiello G, Swam I, Taverne N, Meijerink M, Bron P, Spano G, Kleerebezem M (2016) Strain-specific features of extracellular polysaccharides and their impact on host interactions of Lactobacillus plantarum. Applied and Environmental Microbiology 82:AEM.00306-00316. doi:10.1128/AEM.00306-16
Li M, Wang Q, Song X, Guo J, Wu J, Wu R (2019) iTRAQ-based proteomic analysis of responses of Lactobacillus plantarum FS5-5 to salt tolerance. Annals of Microbiology 69:377-394. doi:10.1007/s13213-018-1425-0
Li Y, Zhou Y, Ma Y, Li X (2011) Design and synthesis of novel cell wall inhibitors of Mycobacterium tuberculosis GlmM and GlmU. Carbohydrate Research 346:1714-1720. doi:https://doi.org/10.1016/j.carres.2011.05.024
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408. doi:10.1006/meth.2001.1262
Lloret J, Wulff B, Rubio J, Downie J, Bonilla I, Rivilla R (1998) Exopolysaccharide II Production Is Regulated by Salt in the Halotolerant Strain Rhizobium meliloti EFB1. Applied and environmental microbiology 64:1024-1028. doi:10.1128/AEM.64.3.1024-1028.1998
Mbye M, Baig MA, AbuQamar SF, El-Tarabily KA, Obaid RS, Osaili TM, Al-Nabulsi AA, Turner MS, Shah NP, Ayyash MM (2020) Updates on understanding of probiotic lactic acid bacteria responses to environmental stresses and highlights on proteomic analyses. Comprehensive Reviews in Food Science and Food Safety 19:1110-1124. doi:https://doi.org/10.1111/1541-4337.12554
Mendonca AA, da Silva PKN, Calazans TLS, de Souza RB, de Barros Pita W, Elsztein C, de Morais Junior MA (2019) Lactobacillus vini: mechanistic response to stress by medium acidification. Microbiology (Reading) 165:26-36. doi:10.1099/mic.0.000738
Nandal K, Sehrawat AR, Yadav AS, Vashishat RK, Boora KS (2005) High temperature-induced changes in exopolysaccharides, lipopolysaccharides and protein profile of heat-resistant mutants of Rhizobium sp. (Cajanus). Microbiol Res 160:367-373. doi:10.1016/j.micres.2005.02.011
Nguyen P-T, Nguyen T-T, Bui D-C, Hong P-T, Hoang Q-K, Nguyen H-T (2020) Exopolysaccharide production by lactic acid bacteria: the manipulation of environmental stresses for industrial applications. AIMS microbiology 6:451-469. doi:10.3934/microbiol.2020027
Nguyen P-T, Nguyen T-T, Vo T-N-T, Nguyen T-T-X, Hoang Q-K, Huu Thanh N (2021) Response of Lactobacillus plantarum VAL6 to challenges of pH and sodium chloride stresses. Scientific Reports 11. doi:10.1038/s41598-020-80634-1
Ninomiya K, Matsuda K, Kawahata T, Kanaya T, Kohno M, Katakura Y, Asada M, Shioya S (2009) Effect of CO₂ concentration on the growth and exopolysaccharide production of Bifidobacterium longum cultivated under anaerobic conditions. J Biosci Bioeng 107:535-537. doi:10.1016/j.jbiosc.2008.12.015
Silva LA, Lopes Neto JHP, Cardarelli HR (2019) Exopolysaccharides produced by Lactobacillus plantarum: technological properties, biological activity, and potential application in the food industry. Annals of Microbiology 69:321-328. doi:10.1007/s13213-019-01456-9
Stingele F, Neeser JR, Mollet B (1996) Identification and characterization of the eps (Exopolysaccharide) gene cluster from Streptococcus thermophilus SFi6. J Bacteriol 178:1680-1690. doi:10.1128/jb.178.6.1680-1690.1996
Vu B, Chen M, Crawford RJ, Ivanova EP (2009) Bacterial extracellular polysaccharides involved in biofilm formation. Molecules 14:2535-2554. doi:10.3390/molecules14072535
Wu Q, Shah NP (2018) Comparative mRNA-Seq Analysis Reveals the Improved EPS Production Machinery in Streptococcus thermophilus ASCC 1275 During Optimized Milk Fermentation. Front Microbiol 9:445. doi:10.3389/fmicb.2018.00445
Zeidan AA, Poulsen VK, Janzen T, Buldo P, Derkx PMF, Oregaard G, Neves AR (2017) Polysaccharide production by lactic acid bacteria: from genes to industrial applications. FEMS Microbiol Rev 41:S168-S200. doi:10.1093/femsre/fux017

Download PDF

Journal Publication

published 13 Jul, 2021

Read the published version in Archives of Microbiology →

Reviews received at journal
26 Apr, 2021
Reviewers invited by journal
25 Apr, 2021
Editor assigned by journal
23 Apr, 2021
First submitted to journal
23 Apr, 2021

You are reading this latest preprint version

Transcriptional Regulation of Exopolysaccharide-related Genes in Lactiplantibacillus Plantarum VAL6 Under Environmental Stresses

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Bacterial strain and culture conditions

Bioreactor operating conditions for stress treatments

Extraction of total RNA and synthesis of first-strand cDNA

Design and synthesis of primers

qPCR experiment

Statistical analysis

Results

Discussion

Declarations

References

Status:

Journal Publication

Version 1