Preparation of GNPs and AS1411 conjugated GNPs
GNPs were synthesized based on a previous reports (21) with some modifications. Briefly, all experimental glasswares were thoroughly washed in Aqua Regia (3 parts HCl and 1 part HNO3), and all solutions were prepared using 18-MΩ-deionized water. Fifty milliliter of HAuCl4 (0.25 mM; Sigma- Aldrich) was reduced with sodium citrate (1% w/v, 2 mL) by boiling and vigorous stirring for 10 min. The resultant reddish-purple suspension was cooled, sterile-filtered and stored in glass bottles at 4 °C. The quality of GNPs was checked using dynamic light scattering (DLS, Malvern Zetasizer Nano ZS, UK) and transmission electron microscopy (TEM: 80 KV, EM10C, Zeiss, Germany).
Thiolated AS1411 Aptamers (5′GGTGGTGGTGGTT-GTGGTGGTGGTGGTTTSH-3’) (BIORON GmbH, Germany) were dissolved in 18-MΩ deionized water. All mixing processes were performed under the laminar flow hood to prevent any contamination. Conjugation of oligonucleotides to the GNPs was achieved using a method based on the protocol reported by Mirkin et al. (22). Briefly, AS1411 aptamers (4 nmol) were reduced by 1 h incubating with tris-(2- carboxyethyl)-phosphine hydrochloride (TCEP: 10 mM; Invitrogen) at room temperature followed by precipitation with ethanol. Then they were added to 10 nm colloidal GNPs (50 mg/L, 3 mL) with shaking and incubating at room temperature for 24 h. The particles were slowly supplemented at room temperature by adding 10X phosphate buffered saline every 12 h until 1X concentration was reached in a period of 48 h. Following incubation, the GNPs complexes were divided into ten 1.5 mL tubes and centrifuged at 12000 g for 45 minutes to separate the unconjugated oligonucleotide. To sterilize, the conjugated GNPs constructs were filtered by 0.2 micrometer PTFE filter before centrifugation. The hydrodynamic size and the quality of AS1411/GNPs were evaluated using UV-Visible spectroscopy and dynamic light scattering (DLS). Prior to use, all nanoparticles were washed by repeated cycles of centrifugation to acquire the excess reactants elimination. The absence of any aggregation resulted from washings step was checked by UV–visible spectra before and after centrifugation; while the band shape and position remained unchanged for all the cases.
Cell culture
Breast cancer cell lines MCF-7 and MDA-MB-231 (Biological Resource Center, Tehran, Iran) and human fibroblast (HFSF-P13) cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with penicillin/streptomycin (1%; Invitrogen), and fetal bovine serum (FBS: 10%, Gibco) at 37 °C in an atmosphere of 5% CO2 incubator.
The study of cancer stem cells has been made easier through an in vitro enrichment technique called mammosphere culture(19). MCF-7 Cells at a density of 1 × 103 cells/ml were placed in serum-free DMEM supplemented with Epidermal Growth Factor (EGF: 20 ng/ml; RoyanBiotech), basic Fibroblast Growth Factor (bFGF:20 ng/ml; RoyanBiotech), Non-Essential Amino Acids (NEAA: 0.1 mM; Gibco), B27 (1X; Invitrogen), penicillin/streptomycin (1%; Invitrogen), in ultralow attachment plates (Costar, USA). Approximately after 5 days the spheres were collected by gentle centrifugation (2 min at 500 g), dissociated with trypsin/EDTA and mechanically disrupted and after centrifugation (5 min, 2500 g) used for next experiments.
Real time PCR
The expression of OCT4-a as the main transcriptional factor that exert key roles in the maintenance of selfrenewal and pluripotency in human embryonic stem cells (23–27) was studied by real time PCR. Total RNA was isolated from adherent or mammospheres cultures using TRIzol reagent (Invitrogen Life Technologies, USA) according to the manufacture instructions. As a positive control, the RNA of human EC cell line NTERA2cl (NT2) was used. After the treatment with DNaseI (Thermo Fisher Scientific, Waltham, MA: USA), cDNA synthesis was performed by the RevertAid™ Reverse Transcriptase kit (Fermentas, GMBH, Germany) and oligo-dT primer (GeneOn, Germany) as instructed by the companies. qPCR was done with specific primers for Oct4-a (forward: CTTCTCGCCCCCTCCAGGT, reverse: AAATAGAACCCCCAGGGTGAGC) and β2M (forward: GTTTCATCCATC reverse: GTTCACGGCA) as internal control. The amplification was performed using qPCR master mix (SYBRGreen: Ampliqon, Herlev, Denmark) with a qPCR instrument (Step One, Applied Biosystems, Korea). The data were evaluated as 2ΔΔCt values (Ct indicates the cycle of threshold). All Ct values calculated from the target genes were normalized to B2M as the reference gene, and the fold change to the control was calculated for the comparison. The resultant real PCR products were resolved on 1% agarose gels stained with Ethidium bromide.
Evaluation of cell toxicity
To determine the cells toxicity following treatment to various concentrations of GNPs and/or AS1411/GNPs aptamer, the cells viability in adherent cells were assessed using the MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, Sigma-Aldrich) assay. The cells were seeded in 96-well plates and 24 hours later were treated with different concentrations of the GNPs (0, 12.5, 25 and 50 mg/L) for an additional 24 hours. The cytotoxicity of the AS1411 aptamer-GNP conjugates, or an equivalent amount of the GNPs alone, was assessed by adding the MTT solution in a fresh medium for 4 h. The cells were collected in DMSO (Dimethyl sulfoxide) and placed on a shaker for 5 minutes. The absorbance of final solution was measured at 540 nm using a 96-well plate reader (ELISA-Reader, Hyperion, Canada). The results were normalized to the control and presented as the percentages of absorbance for untreated control cells. Three independent experiments were done for each data point.
For evaluating the MCF-7 mammosphere cells viability, the MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) assay was used. Seven days after cell seeding in low attachment 96-well plates (Costar) in a density of 1000 cell/mL, the grown mammospheres was exposed to 12.5 mg/L of the GNPs or AS1411/GNPs. After 24 h, the cytotoxicity of the GNPs or AS1411/GNPs was assessed by adding the MTS solution in a fresh medium for 4 h. The absorbance of final solution was measured at 490 nm using a 96-well plate reader (ELISA-Reader, Hyperion, Canada). The results were normalized to the control. Three independent experiments were done for each data point.
GNPs uptake assay
The uptake of GNPs and AS1411/GNP by cancer cells was quantified by atomic absorption spectroscopy (AAS) (SHIMADZU AA-670G, Japan). For AAS measurements, 70,000 _ 100000 cells were seeded per well in 24-well plates in 0.5 mL of a complete culture medium; 24 h post seeding, the cells were treated for another 24 h with 6, 12.5, 25 and 50 mg/L of the GNPs or AS1411/GNPs solutions. At the end of the exposure time, the medium was removed, the wells were washed for 3 times with phosphate-buffered saline (PBS), and exposed to 0.05% Trypsin-EDTA for 2–3 minutes. A fresh complete medium was added and the cells were collected for counting. Then, each sample was collected in a separate tubes and the amount of Au was analyzed by AAS after mineralization with Aqua Regia and sonication. Three independent experiments were carried out and the results were calculated as Au concentration ng/cell.
To show AS1411 aptamer uptake in the cancerous MCF-7 cells and non-cancerous cells (fibroblast cells), we utilized the AS1411 aptamer with 5′-6FAM modification. The cells were seeded in 4-well plates. After 24 h treatment with 1 µM AS1411 aptamer, the cells were washed with PBS for removing extra aptamers prior to fluorescence imaging by an invert fluorescence microscope (Olympus, IX53).
Radiation
Irradiation procedure
4 MeV electron beam was provided to the samples by a Varian linear accelerator (LINAC) (Varian, Clinac 2300C/D, USA) following a dosimetric calibration. The cells were seeded in 12-well plates 48 h prior to irradiation. 24 h post seeding, the cells were exposed to the GNPs and/or AS1411/GNPs (0, 12.5 mg/L) for another 24 h. Before irradiation, the GNP containing medium was replaced with a fresh complete medium. The medium level was adjusted to 7 mm over the cells’ monolayer to place the cells at the approximate dmax of 4 MeV radiation beam. Irradiations were performed using a 25 × 25 cm applicator positioned at the top of dishes. The cells were set at 100 cm distance from the 4 MeV electron source. Irradiations were done in single fractions with a constant dose rate of 1 Gy per monitor unit. The cell culture plates were placed at the center of the electron beam to ensure that all the cells receive a uniform radiation dose. The radiation dose was also monitored and confirmed by using the parallel-plate ion chamber.
Clonogenic survival assay
The effectiveness of radiation in presence of GNPs or AS1411/GNPs was assessed by measuring cell survival and renewal in clonogenic assay. Clonogenic assay is a gold standard assay for the measuring the destructive effect of radiation on cell genome. Following exposure to 0–6 Gy electron beams, cells were washed 3 times by PBS, trypsinized for 2–3 minutes, and re-suspended in complete medium, counted, and replated in six-well culture plates. The cultures were maintained incubated for 14 days without medium change. Cellular colonies were fixed using 10% formalin and then stained with 0.1% crystal violet for colony count. Surviving fractions (SF) were calculated relative to the number of starting plated cells and normalized to the non-irradiated control cells.
To evaluate radiosensitivity of mammospheres a previous protocol reported by Debeb et al. (28) was used with some modifications. Briefly, the mammosphere of MCF7 cells (7 days post culture) were trypsinized into single cells, counted and seeded into the wells of 96-well ultralow attachment plates with a density of 1000 cells/well for 24 h. After 24 h cells were treated with GNPs or AS1411/GNPs for additional 24 h. Then, the plates were exposed to different doses (0, 1, 2, 4 Gy) of 4 MeV beam. After radiation, the cells were incubated for 5 days prior to measurements. Spheres with a minimal size of 50 µm were counted using an invert optical microscope.
Statistical analysis
All experiments were carried out in triplicate and repeated at least for two times. The results are expressed as Mean ± SEM. Statistically significant differences were tested by using one-way analysis of variance for the MTT and MTS assays and two-way analysis of variance for the clonogenic assays, both followed by Tukey’s post-hoc. Clonogenic assays in mammosphere culture was analyzed using Mann-Withney non-parametric test. P values less than 0.05 were considered as statistically significant.