Bacterial strains and culture conditions.
L. plantarum Lac16 (CCTCC, No. M2016259) was isolated in our laboratory and preserved at the China Center for Type Culture Collection. L. plantarum Lac16 was cultured in Mann-Rogosa-Sharpe (MRS) medium and incubated at 37 ℃ for 18 h. C. perfringens type A (ATCC 13124) was cultured in Reinforced clostridium medium (RCM; Hopebio, Qingdao, China) and incubated at 37 ℃ in anaerobic conditions for 18 h.
To determine bacterial concentrations, we centrifuged the overnight-incubated bacterial cultures at 5000 rpm for 5 min. After being washed three times using sterile phosphate-buffered saline (PBS, pH = 7.2), bacteria were resuspended in PBS and their concentrations determined using a standard curve. Then, they were diluted to a certain concentration and stored at 4 ℃.
Agar-diffusion method for detecting bacteriostasis of L. plantarum Lac 16 in a fermentation supernatant.
Agar-diffusion was performed as previously described by Wang et al. [24] with some modifications. Briefly, L. plantarum broth was centrifuged at 5000 rpm for 10 min to obtain the supernatant. The supernatant was filtered through a 0.22 μm membrane to remove suspended bacteria and stored at 4 ℃. About 0.2 % (v/v) of the overnight culture of C. perfringens was added to tryptose sulfite cycloserine (TSC; Hopebio, Qingdao, China) agar which cooled down to about 50 ℃. Then, the medium was well mixed and poured into plastic plates which placed oxford cups in advance. The oxford cups were removed after the medium had solidified. Then, 100 µL of L. plantarum Lac16 fermentation supernatants were injected into each well after which plates were placed in anaerobic gas generating packs (Hopebio, Qingdao, China) for 12 h. This bacteriostatic experiment was performed in triplicates.
Biofilm assays.
Biofilm assays were performed as previously described by Jiang et al. [25] with some modifications. L. plantarum and C. perfringens were cultured in modified RCM medium (glucose content was increased to 20 g/L on the original basis) and incubated at 37 ℃ for 18 h, respectively. Then, the concentration of the C. perfringens culture was adjusted to 107 CFU/mL using the modified RCM medium, after which the supernatant of L. plantarum was collected as described above.
Experimental groups were treated as: i. Sterile modified RCM medium (200 μL) were inoculated into 96-well culture plates and designed as the control group; ii. Resuspended C. perfringens (100 μL) or 100 μL of L. plantarum supernatant were added to 100 μL of sterile modified RCM medium, and designed as the CP or Lac16 fermentation supernatant group; iii. L. plantarum fermentation supernatant (100 μL) and 100 μL of resuspended C. perfringens were inoculated and designed as the experimental treatment group, which was labeled Lac16 fermentation supernatant + Cp group. The 96-well culture plate was incubated in an anaerobic environment at 37 ℃ for 12 h after which the bacterial proliferation index was read at OD600 using SpectraMax M5 (Molecular Devices, USA). Then, bacterial cultures were removed with caution, wells were gently washed thrice using PBS and incubated with 100 μL of 1% crystal violet for 30 min. Crystal violet in the wells was removed and wells were gently washed thrice using PBS. Then, 100 μL of 95% alcohol was added into the wells to dissolve excess crystal violet and OD590 in each well measured. The higher the optical density, the more biofilm formation. Experiments were done in triplicates.
Co-culture experiment and pH determination of cultures.
Bacterial co-culture experiments were done as previously described by Guo et al. [15] with some modifications. L. plantarum and C. perfringens were adjusted to 107 CFU/mL using the modified RCM medium. Ten milliliter of the modified RCM medium were used as the blank control. At the same time, L. plantarum or C. perfringens suspensions (100 μL) were inoculated in 9.9 mL of modified RCM medium as single bacterial strain groups, respectively. Regarding the co-culture system, 100 μL of L. plantarum and C. perfringens were both inoculated in 9.8 mL of modified RCM medium. The above cultures were incubated at 37 ℃ for 12 h, their pH values were determined, after which they were serially diluted, cultured on TSC agar and incubated at 37 ℃ for 12 h to quantitate C. perfringens populations. These experiments were done in triplicates.
Cell cultures.
IPEC-J2 cells were cultured in Dulbecco’s modified Eagle’s F12 ham medium (DMEM/F12; Gibco, MA, USA) supplemented with 10 % (v/v) fetal bovine serum (FBS; Gibco, MA, USA), 100 μg/mL streptomycin and 100 U/mL penicillin (Sigma-Aldrich, MO, USA). Incubation was done at 37 ℃ in an atmosphere of 90 % humidity and 5 % CO2. When cell confluence reached 80 %, cells were digested using 0.25 % trypsin-EDTA solution (Gibco, MA, USA) and seeded in cell culture plates.
Determination of expression levels of HDPs by Real-Time PCR.
IPEC-J2 cells were seeded in 12-well cell culture plates (Corning Life Science, MA, USA) at a density of 5 × 105 cells/well. L. plantarum cultures were centrifuged and resuspended in DMEM/F12 supplemented with 10% FBS and stored at 4 ℃. When IPEC-J2 cells reached 80% confluence, they were co-incubated in cell culture media containing different concentrations of L. plantarum Lac16 (106, 107, and 108 CFU/mL) for 6 h. After being washed three times using PBS, IPEC-J2 cells were lysed by RNAiso Plus (Takara, Dalian, China) to extract RNA. Expression levels of porcine β-defensin (pBD1, pBD2, pBD3) and porcine epididymis protein 2 splicing variant C (pEP2C) were then determined by real-time PCR. All experiments were performed in triplicates.
Cytotoxicity Assay.
IPEC-J2 cells were seeded in 12-well culture plates at a density of 5 × 105 cells/well. When cells reached 80% confluence, they were incubated with or without L. plantarum (107 CFU/mL) for 6 h, respectively. After being washed three times using PBS, cells were infected with C. perfringens (106 CFU/well) under anaerobic conditions for 1 h or 3 h, respectively. Then, cell suspensions were collected and centrifuged at 10 000 rpm/min for 5 min to remove cell debris and bacteria. The release of lactate dehydrogenase (LDH) from damaged cells was measured using the LDH kit (Nanjing Jiancheng Biological Product, Nanjing, China), according to the manufacturer’s instructions. Experiments were performed in triplicates.
C. Perfringens adhesion assay.
Bacterial adhesion assay was performed as previously described by Jiang et al. [25] with some modifications. Briefly, IPEC-J2 cells were seeded in 12-well cell culture plates at a density of 5 × 105 cells/well. At 80% confluence, cells were pre-incubated with L. plantarum (107 CFU/mL) for 6 h, after which C. perfringens were added into the wells (106 CFU/mL) and incubated for 1 h under anaerobic conditions. Cells treated with C. perfringens only were used as the controls. Then, cells were washed three times using sterile PBS to remove non-adherent C. perfringens. Two hundred microliters of 0.25 % trypsin-EDTA solution was added to the wells and digested for 15 min, then, 800 μL sterile PBS was added to each well and completely mixed. Liquids containing bacteria were serially diluted and incubated in TSC agar for 12 h to quantitate C. perfringens populations. Each assay was performed in triplicate.
At the same time, we used fluorescein isothiocyanate (FITC; Solarbio, Beijing, China) labeling method to observe the adhesion effect of C. perfringens. Briefly, the concentration of C. perfringens culture, after centrifuged, was adjusted to 107 CFU/mL with diluted FITC-solution (200 μg/mL). Avoid light and incubate for 2 h at 37 ℃. Then the bacteria were washed with sterile PBS for three times and storaged at 4 ℃. After incubation with L. plantarum Lac16 for 6 h, the cells were washed three times with sterile PBS and co-incubated with C. perfringens (106 CFU/mL), which was labeled with FITC, for 1 h under anaerobic conditions and away from light. Then the cells were washed three times with sterile PBS and examined under a fluorescence microscope (Nikon, Japan). All experiments were performed in triplicate.
Cell permeability to fluorescein sodium.
Cell permeability to fluorescein sodium was assessed as previously described by Nie et al. [26] with some modifications. Briefly, IPEC-J2 cells were seeded in 12-well transwell inserts (Corning Life Science, MA, USA), with pore sizes of 0.4 mm and membrane areas of 1.12 cm2, at a concentration of 1 × 105 cells/mL. Since IPEC-J2 cells can develop tight junctions and differentiate into tight monolayers after 9 days of culture on transwell filters [22], we renewed the culture medium in both apical and basolateral sides of the filters every 24 h for 9 days. On the 10th day, the culture medium on the apical side of the filters was removed and IPEC-J2 cells were treated as described in adhesion assay section. Then, 100 μg/mL fluorescein sodium (Sigma-Aldrich, MO, USA), dissolved in PBS, was added to the apical inserts for 1 h, after which 200 μL of medium from each basolateral side was collected. Fluorescence intensity was determined using a SpectraMax M5 (Molecular Devices, USA) at an excitation wavelength of 495 nm and an emission wavelength of 525 nm. Then, we calculated apical to basolateral flux of fluorescein sodium using the standard curve. Apparent permeability coefficient (Papp) was calculated using the formula: Papp = ΔQ/Δt×(1/AC0) [26]. Whereby, ΔQ/Δt is the permeability rate (μg/s), A is the diffusion area of the monolayer (cm2), while C0 is the initial concentration (μg/mL) of fluorescein sodium in the transwell apical inserts. All experiments were performed in triplicates.
Immunofluorescence analysis.
IPEC-J2 cells (5×105 cell/mL) were seeded on glass coverslips in a 12-well flat-bottom culture plate for at least 9 days to form tight junctions. On the 10th day, the monolayer reaching polarization was treated with bacteria as described in adhesion assay section. Cells were fixed in 4% paraformaldehyde for 20 min at room temperature and blocked with 2.5% bovine serum albumin (BSA; Solarbio, Beijing, China) for 1 h at room temperature. Cells were incubated with rabbit polyclonal anti-ZO-1 primary antibody (Invitrogen, MA, USA) for 12 h at 4 ℃, after which they were incubated with secondary antibody Alexa fluor 488 goat anti-rabbit (Abcam, Cambridge, UK) for 1 h at room temperature and away from light. Nuclei were stained with 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI; Beyotime, Shanghai, China). Fluorescence images were obtained through laser scanning confocal microscopy (LSM 880 with AiryScan) (Zeiss, Germany). All experiments were performed in triplicates.
Periodic acid-Schiff (PAS) staining.
The IPEC-J2 cells (5×105 cell/mL) were grown in 24-well plates (Corning Life Science, MA, USA) for 9 days and pretreated with bacteria as described in adhesion assay section. Then, cells were washed using PBS and fixed in 70% ethanol for 10 min at room temperature. Periodic acid-Schiff staining was performed according to the manufacturer’s instructions (Beyotime, Shanghai, China). Images were obtained using a light microscope (Leica, Germany). Experiments were performed in triplicate.
Quantitative Real-Time PCR.
IPEC-J2 cells were pretreated with bacteria as described in adhesion assay section. Then, cells were lysed using RNAiso Plus (Takara, Dalian, China) to extract RNA. Total RNA was reverse transcribed to cDNA using the HiScript II Q Select RT SuperMix (Vazyme, Nanjing, China). The qRT-PCR analysis was performed using StepOne Plus Real-Time PCR system (Applied Biosystems, USA) and the ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China). Primer sequences used in this study are shown in Table 1. All samples were run in triplicates. β-actin was selected as an endogenous control and relative gene expressions were analyzed using the 2-ΔΔCt method [27]. Each assay was performed in triplicate.
Table 1. Primers used for quantitative real-time PCR
Gene Name
|
Forward sequence (5’→3’)
|
Reverse sequence (5’→3’)
|
Accession Number
|
β-actin
|
CCAGGTCATCACCATCGGCAAC
|
CAGCACCGTGTTGGCGTAGAG
|
DQ845171.1
|
pBD1
|
TTCCTCCTCATGGTCCTGTT
|
AGGTGCCGATCTGTTTCATC
|
NM_213838.1
|
pBD2
|
TGTCTGCCTCCTCTCTTCC
|
AACAGGTCCCTTCAATCCTG
|
AY506573.1
|
pBD3
|
CCTTCTCTTTGCCTTGCTCTT
|
GCCACTCACAGAACAGCTACC
|
XM_021074698.1
|
pEP2C
|
ACTGCTTGTTCTCCAGAGCC
|
TGGCACAGATGACAAAGCCT
|
BK005522.1
|
IL-1β
|
AGAGGGACATGGAGAAGCGA
|
GCCCTCTGGGTATGGCTTT
|
NM_001302388.2
|
IL-6
|
ATCAGGAGACCTGCTTGATG
|
TGGTGGCTTTGTCTGGATTC
|
NM_001252429.1
|
IL-8
|
TCCTGCTTTCTGCAGCTCTC
|
GGGTGGAAAGGTGTGGAATG
|
NM_213867.1
|
TNF-α
|
CTGTAGGTTGCTCCCACCTG
|
CCAGTAGGGCGGTTACAGAC
|
NM_214022.1
|
IL-10
|
GGTTGCCAAGCCTTGTCAG
|
AGGCACTCTTCACCTCCTC
|
NM_214041.1
|
TGF-β
|
GAAGCGCATCGAGGCCATTC
|
GGCTCCGGTTCGACACTTTC
|
XM_021093503.1
|
TLR-1
|
GTCAGTCAGCACCGCAGTAA
|
CAGACAAACTGGAGGGTGGT
|
NM_001031775
|
TLR-2
|
TCACTTGTCTAACTTATCATCCTCT
|
TCAGCGAAGGTGTCATTATTGC
|
NM_213761.1
|
TLR-4
|
GCCATCGCTGCTAACATCATC
|
CTCATACTCAAAGATACACCATCG
|
NM_001113039.2
|
NOD-1
|
CTGTCGTCAACACCGATCCA
|
CCAGTTGGTGACGCAGCTT
|
AB187219.1
|
NOD-2
|
CCTTTTGAAGATGCTGCCTG
|
GATTCTCTGCCCCATCGTAG
|
NM_001105295.1
|
Western blot analysis.
After pretreatment with bacteria as described in adhesion assay section, IPEC-J2 cells were lysed using the RIPA Lysis Buffer (Beyotime, Shanghai, China) involving protease inhibitors. Protein concentrations were measured using the BCA Protein Assay Kit (Beyotime, Shanghai, China). Briefly, protein samples were separated by SDS-PAGE and transferred onto Polyvinylidene difluoride (PVDF) membranes (Millipore, MA, USA). Membranes with migrated proteins were blocked with 5 % dried skimmed milk for 2 h at room temperature and incubated overnight at 4 ℃ with the following primary antibodies: claudin-1 (Abcam, Cambridge, UK), occluding (Abcam, Cambridge, UK), ERK1/2 (Cell Signaling Technology, MA, USA), phospho-ERK1/2 (Cell Signaling Technology, MA, USA), p38 (Cell Signaling Technology, MA, USA), phospho-p38 (Cell Signaling Technology, MA, USA), JNK (Cell Signaling Technology, MA, USA), phospho-JNK (Cell Signaling Technology, MA, USA), p65 (Cell Signaling Technology, MA, USA), phospho-p65 (Cell Signaling Technology, MA, USA), and β-actin (Abcam, Cambridge, UK). After being washed three times for five minutes using Tris-Buffered-Saline with Tween (TBST), membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h at room temperature. Then, protein bands were detected on an image system (Tanon, China) using the chemiluminescent HRP substrate kit (Millipore, MA, USA). Intensities of protein bands were determined using the ImageJ software. All experiments were performed in triplicate.
Statistical Analysis.
Experimental data were analyzed by IBM SPSS Statistics 20 and presented as mean ± SD. Statistical significance between two groups was determined by two-tailed Student’s t test, while multiple comparisons were performed by one-way ANOVA. P ≤ 0.05 was considered significant. Graphs were drawn using the OriginPro 2018 software.