This pilot study aimed to demonstrate a quantifiable MRI signal from melanin production, through gene delivery in a cell lineage of potential use in stroke therapy. Therefore, the gene construct was designed with a strong, constitutive promotor to drive expression over the course of the experiment. Initial studies were performed in 293 HEK cells given their accessibility and ease of use. Then iPS NPCs, a lineage with potential clinical relevance, were assessed through similar experiments. HEK cells were sourced from Carmichael Lab at University of California, Los Angeles, and iPS NPC cells were sourced from Lowry Lab at University of California, Los Angeles.
Gene construct
Human tyrosinase (TYR, NM_000372.3) and tyrosinase-related protein 1 (TYRP1, NM_000550) sequences were acquired from OriGene (Rockville, MD) (cat.no. SC300059 and SC119834, respectively). pCDH-CMV-TYRP1- 2A-copGFP was digested with NotI and SalI and EF1-TYR-2A-copGFP was released from pCDH- EF1-TYR-2A-copGFP by NotI and SalI digestion. Released EF1-TYR-2A-copGFP fragment was then cloned into pCDH-CMV-TYRP1. Constructs were restriction digested and sequenced to confirm identity and tested in vitro for melanin production.
Cell Culture
293 HEK cells were cultured in medium composed of DMEM, 10% fetal bovine serum, glutumax, and pyruvate (Gibco; Waltham, MA). iPS NPC media consisted of DMEM/F12 (Gibco), B27 and N2 supplements (Gibco; Waltham, MA), fibroblast growth factor and epidermal growth factor (Invitrogen; Waltham, MA). 293 HEK cells were plated at a density of 3.5 x 106 and transfected with TYR-TRP-GFP (TransIT 293, Mirus; Madison, WI). 200ŒºM iron citrate (Sigma-Aldrich; Saint Louis, MO) was added to the culture medium 1 day following transfection to simulate in vivo conditions and provide a substrate for melanin scavenging. iPS NPCs were plated at a density of 5 x 104 cm2 and transduced with TYR-TYRP-GFP using lentivirus. Lentivirus was constructed and packaged using standard approaches [18, 19]. The p24 was 5.6 and MOI 30. 200µM iron citrate (Sigma-Aldrich; Saint Louis, MO) and 2mM L-tyrosine (Sigma-Aldrich; Saint Louis, MO) were added to the culture medium 3 days following transduction to account for slower initiation of expression with virus than particles.
Assessment of Melanogenesis
293-HEK and iPS-NPC transgene expression was evaluated qualitatively during cell culture by epifluorescence light microscopy of culture flasks. At 5 days post-transfection, 106 293-HEK cells were resuspended in 1ml PBS for SPECT. Absorbance was measured from 300 to 600 nm. At 7 days post-transfection, iPS-NPCs were harvested for RT-PCR (Invitrogen; Waltham, MA). Forward and reverse TYR primers (Valuegene; San Diego, CA) were: GCGGGATGCAGAAAAGTGTG and TCGGCTACAGACAATCTGCC. RT-PCR products were run on a 1.2% agarose gel (Sigma-Aldrich; Saint Louis, MO). Additionally, iPS-NPC's transduced and cultured in a 24 well plate were assessed on post-transduction day 7 with immunocytochemical (mouse anti-human tyrosinase antibody, Abcam; Cambridge, MA) and Fontana-Mason (Abcam; Cambridge, MA) stains. Control groups were composed of nontransfected iPS-NP cells cultured in iron and L-tyrosine.
In vitro MRI
293-HEK cells were harvested on post-transfection day 5 and mixed with nontransfected cells in ratios of 0:1, 1:4, 1:1, and 1:0 for a total population of 5 x 106 cells. Utilizing a constant cell number eliminates cell settling as a variable in image analysis. Cells were centrifuged and resuspended in 100µl low melting agarose (Sigma-Aldrich; Saint Louis, MO). Cell containing agar was sandwiched between layers of plain agar in a 300µl PCR tube. The phantom was immersed in water and T1 weighted images were acquired on a 3T MRI scanner (Siemens; Ehlangen, Germany).
Photothrombotic stroke (PTS) and intracerebral cell (IC) injection
All experimental protocols were approved by the Animal Research Committee (ARC) at University of California, Los Angeles, and performed in accordance with relevant named guidelines and regulations of the ARC. The authors have complied with ARRIVE guidelines.
11 NOD scid gamma (NSG) mice initially underwent photothrombotic stroke [20]. Subsequently:
1 mouse underwent MRI 7 days after stroke to pilot injection targeting. The brain was stained with tetrazolium chloride (TTC) at this time point to confirm cerebral infarction and also to measure infarct size in preparation for intracerebral cell injections.
On post-stroke day 5, intracerebral 293-HEK cell injections were administered adjacent to the infarct in 10 mice:
5 mice received 293-HEK cells transfected with TYR-TYRP-GFP cultured in iron for 3 days. 5 control group mice received non-transfected 293-HEK cells cultured with iron for 3 days.
225,000 293-HEK cells in 3µl PBS were injected 1mm anterior, posterior, and lateral to the stroke isocenter (775,000 cells/mouse).
Steps (b) through (d) were repeated with iPS-NPCs in 10 mice.
In vivo MRI
1 day after intracerebral injection mice were anesthetized and imaged on a 7T MRI (Bruker; Billerica, MA) utilizing coronal T1, T2 and inversion recovery T1 mapping sequences.
Immunohistochemistry
18 mice were sacrificed 1 day following MRI. Mice were perfused with 4% paraformaldehyde, and sectioned in coronal plane. Slide-mounted frozen sections were stained with human nuclear (HuNu, Abcam; Cambridge, MA), glial fibrillary acidic protein (GFAP, Abcam; Cambridge, MA) and feminizing locus on X-3 (NeuN, Abcam; Cambridge, MA) antibodies as well as 4',6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific; Waltham, MA). Slides were imaged on a confocal microscope (Nikon; Melville, NY).
Statistical Analysis
Descriptive measures and summary statistics were performed using SPSS software version 20.0 [21]. In addition, the Mann-Whitney test and Students' t-test were performed and significance was considered as two-sided p-value < = 0.05.