The role of nicotinic receptors in SARS-CoV-2 receptor ACE2 expression in intestinal epithelia

doi:10.21203/rs.3.rs-46682/v2

Download PDF

Short report

The role of nicotinic receptors in SARS-CoV-2 receptor ACE2 expression in intestinal epithelia

https://doi.org/10.21203/rs.3.rs-46682/v2

This work is licensed under a CC BY 4.0 License

Journal Publication

published 28 Oct, 2020

Read the published version in Bioelectronic Medicine →

You are reading this latest preprint version

Background – Recent evidence demonstrated that severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) propagates in intestinal epithelial cells expressing Angiotensin-Converting Enzyme 2 (ACE2), implying that these cells represent an important entry site for the viral infection. Nicotinic receptors (nAChRs) have been put forward as potential regulators of inflammation and of ACE2 expression. As vagus nerve stimulation (VNS) activates nAChRs, we aimed to investigate whether VNS can be instrumental in affecting intestinal epithelial ACE2 expression.

Methods – By using publicly available datasets we qualified epithelial ACE2 expression in human intestine, and assessed gene co-expression of ACE2 and SARS-CoV-2 priming Transmembrane Serine Protease 2 (TMPRSS2) with nAChRs in intestinal epithelial cells. Next, we investigated mouse and human ACE2 expression in intestinal tissues after chronic VNS via implanted devices.

Results – We show co-expression of ACE2 and TMPRSS2 with nAChRs and α7 nAChR in particular in intestinal stem cells, goblet cells, and enterocytes. However, VNS did not affect ACE2 expression in murine or human intestinal tissue, albeit in colitis setting.

Conclusions – ACE2 and TMPRSS2 are specifically expressed in epithelial cells of human intestine, and both are co-expressed with nAChRs. However, no evidence for regulation of ACE2 expression through VNS could be found. Hence, a therapeutic value of VNS with respect to SARS-CoV-2 infection risk through ACE2 receptor modulation in intestinal epithelia could not be established.

Neurobiology of Disease

Infectious Diseases

vagus nerve stimulation

nAChR

COVID-19

SARS-CoV-2

ACE2

TMPRSS2

Coronavirus disease 2019 (COVID-19), caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), is characterized by a vast release of cytokines. Aggravated by following sepsis, this was established to be the cause of death in 28% of the infected patients(1). At the time of writing this manuscript, no cure nor vaccine exists yet and hence, many studies investigating treatment options have been initiated. Amongst these, vagus nerve stimulation (VNS) has been put forward as potential therapy because of its ability to induce an anti-inflammatory effect through dampening systemic inflammatory responses. This ‘cholinergic anti-inflammatory pathway’ of the vagus nerve has been acknowledged for many years, in particular at the level of sepsis-related cytokines Tumor Necrosis Factor (TNF), Interleukin (IL)-1, and High Mobility Group Box 1 (HMBG1)(2). Therefore, since the COVID-19 outbreak late 2019, several trials (e.g. ClinicalTrials.gov; NCT04341415, NCT04368156, NCT04382391) have been originated to study the efficacy of electrical VNS as treatment for this hyper-inflammatory disease(3, 4). However, clear evidence supporting the value of VNS in treating COVID-19 is lacking.

Thus far, it has been demonstrated that SARS-CoV-2 uses Angiotensin-Converting Enzyme 2 (ACE2) as the key receptor for entry and Transmembrane Serine Protease 2 (TMPRSS2) for viral spike protein priming(5). In addition, increasing evidence suggests that nicotinic receptors (nAChRs) have a pivotal role in the pathogenesis of COVID-19. For instance, an unusually low prevalence of cigarette smoking (characterized by prolonged nAChR activation) was clinically observed in COVID-19 patients(6, 7). This was confirmed by various systematic reviews showing the protective effect of current or former smoking habit against COVID-19 hospitalization(8, 9).

Although ACE2 is abundantly present in lung alveolar epithelial and ciliated cells, the highest ACE2 expression in the human body was found in intestinal enterocytes(10, 11). Intriguingly, nAChRs are equally expressed by enterocytes in the intestinal epithelium(12, 13). The gastrointestinal tract was therefore introduced as target organ for SARS-CoV-2 infection with up to 34% of COVID-19 patients reporting digestive symptoms like diarrhea, nausea, and abdominal discomfort(14). The virus can propagate through ACE2 expressing enterocytes, and viral RNA can be found in rectal swabs, even after negative nasopharyngeal testing(15-17).

The aim of this study is to delineate ACE2 expression in intestinal epithelial cells, and to evaluate the expression of nAChRs in relation to ACE2 in intestinal epithelium. Further, we address the potency of VNS in the reduction of SARS-CoV-2 transmission. To this end, we made use of intestinal tissues of mice and humans that underwent chronic electrical non-invasive VNS administered via implanted devices (Brinkman et al., manuscript in preparation)(18, 19).

Receptor expression assessment
Publicly available single-cell RNA-sequencing data from ileal biopsies obtained from Crohn’s disease patients (GSE134809) was downloaded from the Sequence Read Archive (SRA) whereupon they were aligned against GRCh38 using Cellranger (v3.1.0) and imported into the R statistical environment (v3.6.3)(20, 21). Seurat (v3.1.5) was used to import, integrate, and cluster the data(22, 23). Data visualization was done in ggplot2 (v3.3.1)(24). Louvain clustering analysis identified 22 cell clusters, with clusters 8, 11, 13, 14, and 18 likely representing the epithelial cells based on their expression of CDH1 and VIL1. The epithelial clusters were first filtered for dead cells, identified on the basis of a low gene count and high (>25%) percentage of mitochondrial DNA, whereupon the cell cycle effects were regressed out using the cell cycle genes(25). The epithelial cells were subjected to another round of clustering analysis to identify epithelial subsets(26). Specifically, we identified stem cells (LGR5, ASCL2, OLFM4, GKN3, SLC12A2, AXIN2), goblet cells (MUC2, TFF3, CLCA3, AGR2), enterocytes (FABP1, ALPI, APOA1, APOA4), enteroendocrine cells (CHGA, CHGB, TAC1, TPH1, NEUROG3), and tuft cells (DCLK1, TRPM5, GFI1B, IL25)(27, 28). Subsequently, co-expression of ACE2 and TMPRSS2 with nAChRs was assessed.

VNS in humans
VNS of the left cervical vagus nerve was performed in patients with active Crohn’s disease continuously for 12 months as was described previously (FIG. 1B)(18, 19). Ileal and colonic biopsies were collected during ileocolonoscopy prior to start of VNS, and 6 and 12 months after start of VNS. These biopsies were used for mRNA expression assessments. In total, 9 patients were included in the study. Of these, 2 patients were removed from the study after a 3-month follow-up because of worsened clinical state. After 1 year of VNS, 5 out of 7 patients were in clinical remission (assessed with the Crohn’s Disease Activity Index, CDAI), and 6 in endoscopic remission (assessed with the Crohn’s Disease Endoscopic Index of Severity, CDEIS).

The study was approved by the Institutional Ethics Review Board (Identifier 11-CHUG-28), registered at ClinicalTrials.gov (NCT01569503), and was conducted in accordance with the Helsinki Declaration and the Good Clinical Practice guidelines of the International Council.

Animals
Female C57BL/6NCrl inbred mice (10 weeks old) were obtained from Charles River Laboratories, Maastricht, the Netherlands and acclimated for 1 week before performing experiments. The animals were housed under specific pathogen-free conditions in the animal facility at the Amsterdam University Medical Centers, location AMC, Amsterdam, the Netherlands. Animals were maintained on a 12/12 light/dark cycle under constant temperature (20°C ± 2°C ) and humidity (55%) conditions with ad libitum drinking water and chow. Mice were handled according to the guidelines of the Animal Research Ethics Committee of the University of Amsterdam. Experiments were conducted under a project (application number AVD118002017842; license holder number 11800) approved by the Dutch Central Animal Experiments Committee. Individual experiments were revised and approved by the Animal Research Ethics Committee of the University of Amsterdam. Prior to the experiments protocols were approved by this same committee. A total of 32 mice were used for this study.

VNS in mice
100 μm sling cuff electrodes (Micro Cuff Sling, Ref No 1041.2406.51; CorTec GmbH, Freiburg, Germany) were implanted around the left cervical vagus nerve. The electrode was attached to Preci-Dip 1.27 mm 2 Way 1 Row Straight Through (Ref No 702-0092; RS Components B.V., Haarlem, the Netherlands) with PRO Silver Conductive Paint (Ref No 123-9911; RS Components B.V.). The procedure was performed on mice under anesthesia with 2.5% isoflurane in 100% O₂ (flow 1 L/min). Preoperatively and 24 hours postoperatively animals were administered meloxicam 1 mg/kg (Metacam; Boehringer, Ingelheim am Rein, Germany) and enrofloxacin (Baytril; Beyer Healthcare, Whippany, NJ, United States of America) 5 mg/kg. Local anesthetics were administered through a lidocaine splash block (2%) before wound closure. Mice recovered for 10 days. At day 0, mice were allocated to the sham group when the impedance measurement of the implanted cuff was above 25 kΩ. Other mice were pair-matched based on weight, after which they were randomly allocated (1:1) to the sham or stim group. The sham group counted 14 mice and the stimulated group counted 16 mice.

Bipolar stimulation was performed for 2 min 6 times daily for 12 days with the following parameters: 650 μAmp, 10 Hz, pulse width 200 μs (FIG. 1A)(29). Proper stimulation was examined by observing behavioral changes of the mice (e.g. altered breathing, decreased movements). Also, before, during, and after the experiment, impedance measurements (using a single frequency of 1 kHz) with a Minirator MR Pro (NTI Audio, Essen, Germany) on the cuff electrodes were performed to ensure proper conduction . Further, the vagus nerves with cuffs from randomly selected mice were collected. After paraffin embedding, a hematoxylin-eosin (HE) staining was conducted to assess damage of the nerve. At the end of the study, mice were euthanized.

DSS treatment

All animals were treated with dextran sodium sulphate (DSS) to induce acute colitis. 2.25% (w/v) DSS (TdB Consultancy, Uppsala, Sweden) was added to the drinking water for 5 consecutive days. Drinking water with fresh DSS solution was replaced daily. Following DSS-treatment, mice received normal drinking water for 7 days, adding up to a total experiment length of 12 days. During the study, bodyweight and behavior were monitored daily. VNS was started at the same day as DSS treatment.

mRNA expression analysis
mRNA was extracted from frozen ileal and colonic tissue after lysis in ISOLATE II RNA Lysis Buffer RLY and isolation according to the Bioline ISOLATE II RNA mini kit (both GC biotech b.v. Alphen a/d Rijn, the Netherlands) and cDNA was synthesized by use of the Revertaid first strand cDNA synthesis kit (ThermoFisher Scientific, Landsmeer, the Netherlands). qPCR was performed using SensiFAST SYBR No-ROX (GC biotech b.v.) on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories B.V., Veenendaal, the Netherlands) and expression levels were analyzed using LinRegPCR software(30). Expression levels were normalized for reference genes Eef2, Nono, and Gapdh for mouse and ACTB, PSMB6, and RPLP0 for human after stability assessment with geNorm(31). Primers (all Sigma-Aldrich Chemie N.V., Zwyndrecht, the Netherlands) are listed in Table 1.

Table 1. Primer sequences

Gene	Forward sequence (5’ to 3’)	Reverse sequence (5’ to 3’)
mEef2	TGTCAGTCATCGCCCATGTG	CATCCTTGCGAGTGTCAGTGA
mNono	AAAGCAGGCGAAGTTTTCATTC	ATTTCCGCTAGGGTTCGTGTT
mGapdh	ATGTGTCCGTCGTGGATCTGA	ATGCCTGCTTCACCACCTTCT
mAce2	TCCAGACTCCGATCATCAAGC	GCTCATGGTGTTCAGAATTGTGT
mVil1	CTCAAGACTCCGTCCTGCTG	CCACTTGTTTCTCCGTCCGA
mCdh1	AACCCAAGCACGTATCAGGG	GAGTGTTGGGGGCATCATCA
hACTB	AATGTGGCCGAGGACTTTGA	TGGCTTTTAGGATGGCAAGG
hPSMB6	ACCTGATGGCGGGAATCAT	ATCATACCCCCCATAGGCACT
hRPLP0	TGTGGGAGCAGACAATGTGG	TGAGGCAGCAGTTTCTCCAG
hACE2	CGAAGCCGAAGACCTGTTCTA	GGGCAAGTGTGGACTGTTCC
hVIL1	CCAAAGGCCTGAGTGAAATC	CCTGGAGCAGCTAGTGAACA
hCDH1	ATTTTTCCCTCGACACCCGAT	TCCCAGGCGTAGACCAAGA

Statistical analysis
Graphs were made with GraphPad Prism 8.0 (GraphPad Software, La Jolla, CA, USA) and a Mann-Whitney U test (2 groups) or a Kruskal-Wallis test (>2 groups) was used to check for statistical significance. In all tests, P<0.05 was accepted as an indication for statistical significance. All data are expressed as median with interquartile range plus the individual data points.

ACE2 and TMPRSS2 co-express with nAChRs in stem cells, goblet cells, and enterocytes

We first investigated which cells express ACE2 and TMPRSS2 in the human intestinal context. To this end, we obtained the data from GSE134809 including single-cell RNA-sequencing on inflamed and uninflamed ileal biopsies from patients with Crohn’s disease(20). Unsupervised clustering analysis identified 22 clusters (FIG. 2A), with clusters 8, 11, 13, 14, and 18 likely representing the epithelial cells based on their expression of E-cadherin (CDH1) and Villin-1 (VIL1) (FIG. 2B and 2C). Expectedly, both ACE2 and TMPRSS2 were expressed in the same clusters confirming specific gene expression in epithelial cells in ileum. Subsequent clustering analysis of the epithelial cells yielded 15 subclusters (FIG. 2D), in which we identified stem cells (LGR5, ASCL2, OLFM4, GKN3, SLC12A2, AXIN2), goblet cells (MUC2, TFF3, CLCA3, AGR2), enterocytes (FABP1, ALPI, APOA1, APOA4), enteroendocrine cells (CHGA, CHGB, TAC1, TPH1, NEUROG3), and tuft cells (DCLK1, TRPM5, GFI1B, IL25) (FIG. 2D)(27, 28). Visualizing the expression of ACE2 or TMPRSS2 alongside the expression of the nAChR genes revealed co-expression in stem cells, goblet cells, and enterocytes for CHRNA5, CHRNA7, CHRNA10, CHRNB1, and CHRNE (encoding nAChR subunits α5, α7, α10, β1, and ε, respectively).

Notably, ACE2 is clearly expressed in goblet cells, although it has been demonstrated that SARS-CoV and SARS-CoV-2 cannot infect goblet cells in both airway and intestinal epithelia(15). Moreover, the nAChR that was mostly co-expressed with ACE2 and TMPRSS2 was α7 nAChR (encoded by CHRNA7). This is an essential regulator of inflammation by inhibiting cytokine release through the aforementioned cholinergic anti-inflammatory pathway(32). This is relevant because Russo and Leung reported on the role of α7 nAChR in SARS-CoV-2 and demonstrated that smoking results in an upregulation of α7 nAChR leading to an increase of ACE2(33-35).

Chronic electrical VNS does not alter intestinal ACE2 expression in mice and humans

As a positive correlation of ACE2 and CHRNA7 was previously observed, and chronic cholinergic stimulation typically leads to upregulation of nAChRs, we investigated whether chronic VNS affected the expression of ACE2(35, 36). Accordingly, intestinal ileal tissues of mice that were subjected to electrical chronic VNS, applied via an implantable device, were obtained and analyzed for Ace2 mRNA expression. Adequate VNS was confirmed by behavioral changes of the mice, impedance measurements, and HE stainings not showing any damage of the vagus nerve caused by the cuff electrodes (FIG. 3). Our data show no effect on Ace2 expression levels. Since samples contained bulk RNA of intestine, values were corrected for epithelial markers Cdh1 and Vil1 to determine the epithelial fraction. Also after correction, no differences were observed (FIG. 4A).

Next, we assessed ACE2 mRNA expression in human intestinal tissues of patients treated with chronic VNS as was described previously(18, 19). In line with the mouse data, no differential expression was observed between samples collected prior to VNS and 6 and 12 months after start VNS. Correction for CDH1 and VIL1, markers that have shown to be stable under inflammatory conditions (data not shown), did not alter the results (FIG. 4B). Though not significant, a trend towards higher levels of ACE2 at 12 months VNS could be detected. Noticeably, ACE2 expression levels in colon samples were relatively low when compared with ileal samples, which is corroborated by earlier literature showing low basal expression levels of ACE2 in colonic tissue(11).

It should be mentioned that in this study we made use of already available tissues. Thus, stimulation parameters such as duration of stimulation, pulse width, and frequency were not optimized for the current research question. In addition, both VNS experiments have been performed in diseased subjects; mice were exposed to DSS inducing colitis, and all humans had active Crohn’s disease. ACE2 has been shown to be upregulated in inflammatory bowel diseases (IBD), and in ileum in particular(37-39). For that reason, in our experiments, basal ACE2 expression levels might have been higher when compared with healthy subjects because of the colitis background of the tissues, possibly mitigating the results. The considerable divergence between ileal and colonic expression levels substantiates this confounding effect. Though, our analyses did not show significant differences between uninflamed and inflamed samples (FIG. 4B).

Data on the role of α7 nAChRs in colitis are conflicting. Sun et al. demonstrated increased CHRNA7 expression upon 2,4,6-trinitrobenzenesulfonic acid (TNBS)-induced colitis, whereas Baird et al. found decreased CHRNA7 expression in IBD(40, 41). Further, in an experimental colitis model, selective α7 nAChR agonists worsened disease(42). These data imply that colitis is associated with CHRNA7 expression, again modifying the ACE2 expression levels perchance confusing the current results.

Importantly, when in this manuscript we focus on nicotinic receptors and α7 nAChR specifically, it is important to note that other receptors might play a role in regulating ACE2 as well since VNS unequivocally activates other acetylcholine-binding receptor types. This was not examined in this study.

In addition, we show that VNS does not alter intestinal ACE2 mRNA expression levels, protein expression levels, which might be of more importance in this context, have not been assessed. Hence, an effect on SARS-CoV-2 infection could still be observed. This is substantiated by Lamers et al. who demonstrated that SARS-CoV-2 infection of gut enterocytes is independent from the ACE2 expression level(15). Conversely, since SARS-CoV-2 is known to downregulate ACE2 expression, it is plausible that VNS could restore ACE2 levels in infected patients(43, 44). To this end, VNS studies including SARS-CoV-2 infected patients should be performed.

Regardless of the ACE2 expression level, the antagonizing effect of VNS on the devastating systemic cytokine storm might strengthen this intervention as potential treatment for COVID-19. This is greatly underlined by the positive outcomes of the RECOVERY trial studying the effect of low-dose steroid treatment with dexamethasone on SARS-CoV-2(45). Alike VNS, dexamethasone is acknowledged as inhibitor of the production of pro-inflammatory cytokines(46, 47).

Concerning the effect of VNS on systemic cytokine responses, a critical note is that these responses depend on the stimulation parameters such as frequency, amplitude, and pulse width as was demonstrated by Tsaava et al., and recently reviewed(48, 49). Although low frequency stimulation (as was used in our studies) was not examined, stimulation with high amplitudes resulted in an increase in IL-6 and decrease in IL-5 and TNF-α. When refining these parameters in VNS, the subsequent positive regulation of cytokines could substantiate the role of VNS in treating COVID-19.

Finally, granting the potential role for VNS in SARS-CoV-2 infection, one must be aware that parasympathetic neuronal activity through the vagus nerve can induce bronchoconstriction, an absolutely undesirable adverse effect in COVID-19 patients(50). Even though results on this matter are conflicting, application of VNS in these patients must be performed with great caution(51, 52). To elucidate and overcome this issue, future studies should focus on more specific stimulation techniques exclusively targeting the cytokine-producing organ of interest.

The implication of VNS as treatment for SARS-CoV-2 infection has gained high interest. Here, we show that despite gene co-expression of nAChRs, ACE2, and TMPRSS2 in the intestinal epithelium, chronic non-invasive electrical VNS does not significantly alter intestinal ACE2 expression at a transcriptional level. As bio-electronic neuromodulatory techniques continue to evolve as treatment for controlling inflammation, and with the current SARS-CoV-2 outbreak for COVID-19 in particular, further experimental investigations are needed to shed light on the therapeutic potential of VNS for SARS-CoV-2 infection control.

ACE2: Angiotensin-Converting Enzyme 2; COVID-19: coronavirus disease 2019; DSS: dextran sodium sulphate; HMBG1: High Mobility Group Box 1; IBD: inflammatory bowel disease; IL: interleukin; mRNA: messenger RNA; nAChR: nicotinic receptor; qPCR: quantitative polymerase chain reaction; SARS-CoV-2: Severe Acute Respiratory Syndrome Coronavirus 2; TMPRSS2: Transmembrane Serine Protease 2; TNBS: 2,4,6-trinitrobenzenesulfonic acid; TNF: Tumor Necrosis Factor; UMAP: uniform manifold approximation and projection; VNS: vagus nerve stimulation.

Acknowledgments

Not applicable.

Authors’ contributions

A.S.t.H, D.J.B., M.D.L., and W.J.d.J. conceptualized and wrote the manuscript. A.S.t.H., D.J.B., A.Y.L., C.V., T.B.M.H., I.A., O.W., V.S., and B.B. performed experiments and analyzed and interpreted results. A.S.t.H., D.J.B., A.Y.L., B.B., M.D.L., and W.J.d.J. drafted and edited the final manuscript.

Funding
M.D.L. has received research grants from KWF Kankerbestrijding (Dutch Cancer Foundation), grant number 10495, and Medtronic. W.J.d.J. has received research grants from Health Holland TKI, grant numbers LSH16010 and LSH17028, Horizon 2020, grant numbers H2020-MSCA-ITN-2015 and H2020-MSCA-ITN-2018, Gut Research Services and Mead Johnsson Nutrition.

Availability of data and materials

Not applicable.

Ethics approval and consent to participate

Mice were handled in accordance with the guidelines of the Animal Research Ethics Committee of the University of Amsterdam and prior to the experiments the same ethics committee approved the experimental protocols.

Considering the human samples, the study was approved by the Institutional Ethics Review Board (Identifier 11-CHUG-28), registered at ClinicalTrials.gov (NCT01569503), and was conducted in accordance with the Helsinki Declaration and the Good Clinical Practice guidelines of the International Council.

Consent for publication

Not applicable.

Competing interests

The authors declare no conflicts of interest.

Zhang B, Zhou X, Qiu Y, Feng F, Feng J, Jia Y, et al. Clinical characteristics of 82 death cases with COVID-19. medRxiv. 2020:2020.02.26.20028191.
Tracey KJ. The inflammatory reflex. Nature. 2002;420(6917):853-9.
Staats P, Giannakopoulos G, Blake J, Liebler E, Md R. Use of non‐invasive vagus nerve stimulation to treat respiratory symptoms associated with COVID‐19: A theoretical hypothesis and early clinical experience. Neuromodulation: Technology at the Neural Interface. 2020.
Fudim M, Qadri YJ, Ghadimi K, MacLeod DB, Molinger J, Piccini JP, et al. Implications for Neuromodulation Therapy to Control Inflammation and Related Organ Dysfunction in COVID-19. J Cardiovasc Transl Res. 2020.
Hoffmann M, Kleine-Weber H, Schroeder S, Kruger N, Herrler T, Erichsen S, et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell. 2020;181(2):271-80 e8.
Creamer MR, Wang TW, Babb S, Cullen KA, Day H, Willis G, et al. Tobacco Product Use and Cessation Indicators Among Adults - United States, 2018. MMWR Morb Mortal Wkly Rep. 2019;68(45):1013-9.
Petrilli CM, Jones SA, Yang J, Rajagopalan H, O'Donnell L, Chernyak Y, et al. Factors associated with hospital admission and critical illness among 5279 people with coronavirus disease 2019 in New York City: prospective cohort study. BMJ. 2020;369:m1966.
Farsalinos K, Niaura R, Le Houezec J, Barbouni A, Tsatsakis A, Kouretas D, et al. Editorial: Nicotine and SARS-CoV-2: COVID-19 may be a disease of the nicotinic cholinergic system. Toxicol Rep. 2020.
Team CC-R. Preliminary Estimates of the Prevalence of Selected Underlying Health Conditions Among Patients with Coronavirus Disease 2019 - United States, February 12-March 28, 2020. MMWR Morb Mortal Wkly Rep. 2020;69(13):382-6.
Hamming I, Timens W, Bulthuis ML, Lely AT, Navis G, van Goor H. Tissue distribution of ACE2 protein, the functional receptor for SARS coronavirus. A first step in understanding SARS pathogenesis. J Pathol. 2004;203(2):631-7.
Qi F, Qian S, Zhang S, Zhang Z. Single cell RNA sequencing of 13 human tissues identify cell types and receptors of human coronaviruses. Biochem Biophys Res Commun. 2020;526(1):135-40.
Richardson CE, Morgan JM, Jasani B, Green JT, Rhodes J, Williams GT, et al. Effect of smoking and transdermal nicotine on colonic nicotinic acetylcholine receptors in ulcerative colitis. QJM. 2003;96(1):57-65.
Summers AE, Whelan CJ, Parsons ME. Nicotinic acetylcholine receptor subunits and receptor activity in the epithelial cell line HT29. Life Sci. 2003;72(18-19):2091-4.
Yang L, Tu L. Implications of gastrointestinal manifestations of COVID-19. Lancet Gastroenterol Hepatol. 2020.
Lamers MM, Beumer J, van der Vaart J, Knoops K, Puschhof J, Breugem TI, et al. SARS-CoV-2 productively infects human gut enterocytes. Science. 2020:eabc1669.
Amirian ES. Potential fecal transmission of SARS-CoV-2: Current evidence and implications for public health. Int J Infect Dis. 2020;95:363-70.
Xiao F, Tang M, Zheng X, Liu Y, Li X, Shan H. Evidence for Gastrointestinal Infection of SARS-CoV-2. Gastroenterology. 2020;158(6):1831-3 e3.
Bonaz B, Sinniger V, Hoffmann D, Clarencon D, Mathieu N, Dantzer C, et al. Chronic vagus nerve stimulation in Crohn's disease: a 6-month follow-up pilot study. Neurogastroenterol Motil. 2016;28(6):948-53.
Sinniger V, Pellissier S, Fauvelle F, Trocme C, Hoffmann D, Vercueil L, et al. A 12-month pilot study outcomes of vagus nerve stimulation in Crohn's disease. Neurogastroenterol Motil. 2020:e13911.
Martin JC, Chang C, Boschetti G, Ungaro R, Giri M, Grout JA, et al. Single-Cell Analysis of Crohn's Disease Lesions Identifies a Pathogenic Cellular Module Associated with Resistance to Anti-TNF Therapy. Cell. 2019;178(6):1493-508 e20.
R Core Team. R: A Language and Environment for Statistical Computing Vienna, Austria 2016 [Available from: https://www.R-project.org/.
Butler A, Hoffman P, Smibert P, Papalexi E, Satija R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat Biotechnol. 2018;36(5):411-20.
Stuart T, Butler A, Hoffman P, Hafemeister C, Papalexi E, Mauck WM, 3rd, et al. Comprehensive Integration of Single-Cell Data. Cell. 2019;177(7):1888-902 e21.
Wickham H. (2016). ggplot2: Elegant Graphics for Data Analysis. Springer-Verlag New York. ISBN 978-3-319-24277-4, https://ggplot2.tidyverse.org/.
Nestorowa S, Hamey FK, Pijuan Sala B, Diamanti E, Shepherd M, Laurenti E, et al. A single-cell resolution map of mouse hematopoietic stem and progenitor cell differentiation. Blood. 2016;128(8):e20-31.
Luecken MD, Theis FJ. Current best practices in single-cell RNA-seq analysis: a tutorial. Mol Syst Biol. 2019;15(6):e8746.
Haber AL, Biton M, Rogel N, Herbst RH, Shekhar K, Smillie C, et al. A single-cell survey of the small intestinal epithelium. . Nature. 2017;551(7680):333-9.
Grun D, Lyubimova A, Kester L, Wiebrands K, Basak O, Sasaki N, et al. Single-cell messenger RNA sequencing reveals rare intestinal cell types. Nature. 2015;525(7568):251-5.
Guyot M, Simon T, Panzolini C, Ceppo F, Daoudlarian D, Murris E, et al. Apical splenic nerve electrical stimulation discloses an anti-inflammatory pathway relying on adrenergic and nicotinic receptors in myeloid cells. Brain Behav Immun. 2019;80:238-46.
Ruijter JM, Ramakers C, Hoogaars WM, Karlen Y, Bakker O, van den Hoff MJ, et al. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009;37(6):e45.
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3(7):RESEARCH0034.
Wang H, Yu M, Ochani M, Amella CA, Tanovic M, Susarla S, et al. Nicotinic acetylcholine receptor alpha7 subunit is an essential regulator of inflammation. Nature. 2003;421(6921):384-8.
Leung JM, Yang CX, Tam A, Shaipanich T, Hackett TL, Singhera GK, et al. ACE-2 expression in the small airway epithelia of smokers and COPD patients: implications for COVID-19. Eur Respir J. 2020;55(5).
Russo P, Bonassi S, Giacconi R, Malavolta M, Tomino C, Maggi F. COVID-19 and Smoking. Is Nicotine the Hidden Link? Eur Respir J. 2020.
Leung JM, Yang CX, Sin DD. COVID-19 and Nicotine as a Mediator of ACE-2. Eur Respir J. 2020.
Melroy-Greif WE, Stitzel JA, Ehringer MA. Nicotinic acetylcholine receptors: upregulation, age-related effects and associations with drug use. Genes Brain Behav. 2016;15(1):89-107.
Hashimoto T, Perlot T, Rehman A, Trichereau J, Ishiguro H, Paolino M, et al. ACE2 links amino acid malnutrition to microbial ecology and intestinal inflammation. Nature. 2012;487(7408):477-81.
Bangma A, Voskuil MD, Weersma RK. TNFalpha-antagonist use and mucosal inflammation are associated with increased intestinal expression of SARS-CoV-2 host protease TMPRSS2 in patients with inflammatory bowel disease. Gastroenterology. 2020.
Krzysztof NJ, Christoffer LJ, Rahul K, Ricanek P, Jonas H, Jack S. Age, inflammation and disease location are critical determinants of intestinal expression of SARS-CoV-2 receptor ACE2 and TMPRSS2 in inflammatory bowel disease. Gastroenterology. 2020.
Baird A, Coimbra R, Dang X, Eliceiri BP, Costantini TW. Up-regulation of the human-specific CHRFAM7A gene in inflammatory bowel disease. BBA Clin. 2016;5:66-71.
Sun YP, Wang HH, He Q, Cho CH. Effect of passive cigarette smoking on colonic alpha7-nicotinic acetylcholine receptors in TNBS-induced colitis in rats. Digestion. 2007;76(3-4):181-7.
Snoek SA, Verstege MI, van der Zanden EP, Deeks N, Bulmer DC, Skynner M, et al. Selective alpha7 nicotinic acetylcholine receptor agonists worsen disease in experimental colitis. Br J Pharmacol. 2010;160(2):322-33.
Glowacka I, Bertram S, Herzog P, Pfefferle S, Steffen I, Muench MO, et al. Differential downregulation of ACE2 by the spike proteins of severe acute respiratory syndrome coronavirus and human coronavirus NL63. J Virol. 2010;84(2):1198-205.
Kuba K, Imai Y, Rao S, Gao H, Guo F, Guan B, et al. A crucial role of angiotensin converting enzyme 2 (ACE2) in SARS coronavirus-induced lung injury. Nat Med. 2005;11(8):875-9.
University of Oxford. Low-cost dexamethasone reduces death by up to one third in hospitalised patients with severe respiratory complications of COVID-19. Manuscript in preparation.
Horton DL, Remick DG. Delayed addition of glucocorticoids selectively suppresses cytokine production in stimulated human whole blood. Clin Vaccine Immunol. 2010;17(6):979-85.
Nyhlen K, Gautam C, Andersson R, Srinivas U. Modulation of cytokine-induced production of IL-8 in vitro by interferons and glucocorticosteroids. Inflammation. 2004;28(2):77-88.
Tsaava T, Datta-Chaudhuri T, Addorisio ME, Masi EB, Silverman HA, Newman JE, et al. Specific vagus nerve stimulation parameters alter serum cytokine levels in the absence of inflammation. Bioelectronic medicine. 2020;6:8.
Bonaz B. Parameters matter: modulating cytokines using nerve stimulation. Bioelectronic medicine. 2020;6:12.
Belmonte KE. Cholinergic pathways in the lungs and anticholinergic therapy for chronic obstructive pulmonary disease. Proc Am Thorac Soc. 2005;2(4):297-304; discussion 11-2.
Miner JR, Lewis LM, Mosnaim GS, Varon J, Theodoro D, Hoffmann TJ. Feasibility of percutaneous vagus nerve stimulation for the treatment of acute asthma exacerbations. Acad Emerg Med. 2012;19(4):421-9.
Steyn E, Mohamed Z, Husselman C. Non-invasive vagus nerve stimulation for the treatment of acute asthma exacerbations-results from an initial case series. Int J Emerg Med. 2013;6(1):7.

Download PDF

Journal Publication

published 28 Oct, 2020

Read the published version in Bioelectronic Medicine →

Editorial decision: Accept
09 Sep, 2020
Reviewer #2 agreed at journal
07 Sep, 2020
Review #2 received at journal
07 Sep, 2020
Editor assigned by journal
26 Aug, 2020
Reviewers invited by journal
26 Aug, 2020
Reviewer #1 agreed at journal
26 Aug, 2020
Review #1 received at journal
26 Aug, 2020
Submission checks completed at journal
25 Aug, 2020
Editor invited by journal
25 Aug, 2020

You are reading this latest preprint version

The role of nicotinic receptors in SARS-CoV-2 receptor ACE2 expression in intestinal epithelia

Status:

Journal Publication

Version 2

Abstract

Figures

Background

Methods

Results and Discussion

Conclusions

Abbreviations

Declarations

References

Status:

Journal Publication

Version 2