Animal care
All experiments were performed in accordance with the German legislation governing animal studies, following the “Principles of Laboratory Animal Care” [13]. Official permission was granted by the North Rhine-Westphalia State Office for Nature, the Environment and Consumer Protection (Landesamt für Natur, Umwelt und Verbraucherschutz Nordrhein-Westfalen, Recklinghausen, Germany, project number: 84.02.04.2014 A265), which also approved all experimental protocols. Male German landrace pigs (German Landrace Sus scrofa) with a body weight of 30 ± 5 kg were housed with a 12 h day/night rhythm 7 days before the experiments to allow acclimatization to their surroundings. Pre-infection was excluded by a veterinarian examination of all animals before the experiments started. The data presented in this paper were collected in the context of a larger study [14] for the benefit of the principles of the 3Rs (Replacement, Refinement, and Reduction) [15].
General instrumentation, anesthesia, and surgical procedures
The experimental setup was established and validated at the Department of Trauma and Reconstructive Surgery, RWTH, Aachen and was described in detail by Horst et al. in 2016 [14]. Prior to the experiment, animals were premedicated with an intramuscular injection of azaperone. Anesthesia then was induced by an intravenous injection of propofol followed by orotracheal intubation (7.5 ch; Hi-Lo LanzTM). Vital parameters were monitored by electrocardiographic (ECG) recordings and ECG-synchronized pulse oximetry, as previously described [14]. A central venous line was placed into the right jugular vein (Four-Lumen Catheter, 8.5 Fr., Arrow Catheter, Teleflex Medical, Germany). A three-lumen hemodialysis catheter (12.0 Fr., Arrow Catheter, Teleflex Medical, Germany) was also placed in the right femoral vein to induce hemorrhage, and an arterial line (Vygon, Aachen, Germany) was placed in the femoral artery for continuous monitoring of blood pressure. A suprapubic bladder catheter was also placed. Anesthesia was maintained with propofol and sufentanil during the entire study period. Fluids were administered by continuous crystalloid infusion (Sterofundin ISO®).
Experimental groups
Pigs either sustained monotrauma (isolated femur fracture, n=12) or polytrauma (femoral fracture, chest and abdominal trauma, hemorrhage of max. 45% of the total blood volume, n=12). Non-injured animals that received the same instrumentation, medication, and treatment, but no trauma, served as sham group (n=6). The fractures sustained by the “Monotrauma” and “Polytrauma” groups were stabilized either by external fixation (Radiolucent Fixator, Orthofix, n=6) or by intramedullary nailing (T2 System, Stryker, n=6). In addition to the sham group, four experimental groups were included: Monotrauma Nailing (Mono_N, n=6), Monotrauma External Fixation (Mono_Ex_fix, n=6), Polytrauma Nailing (Poly_N, n=6), and Polytrauma External Fixation (Poly_Ex_fix, n=6).
Trauma Induction and 72 h ICU phase
After achieving stable baseline values (at least 120 minutes after instrumentation) for O2 at 21% during the trauma period, simulating the ambient air, either monotrauma or multiple trauma was induced. The femur fracture was achieved using a bolt gun machine (Blitz-Kerner, turbocut JOBB GmbH, Germany) and cattle-killing cartridges (9 × 17; DynamitNobel AG, Troisdorf, Germany). The bolt hit a custom-made punch positioned on the mid third of the femur [14], For polytrauma, a pair of panels (steel: 0.8 cm and lead: 1.0 cm thickness) was placed on the right dorsal, lower chest. A bolt was shot onto this panel, simulating a blunt lung contusion. An additional laparotomy was performed to approach the liver and the mid-lobe of the liver was cut crosswise (4.5 x 4.5cm) to half of the liver thickness in depth, with uncontrolled bleeding allowed for 30 s. The liver was then packed with 10 × 10cm gauze and the laparotomy was closed. A pressure-controlled and volume-limited hemorrhagic shock was then induced by withdrawing blood until a mean arterial pressure (MAP) of 40 ± 5 mmHg was reached. In this context, a maximum of 45% of the total blood volume was drawn from the left femoral vein. The shed blood was kept in blood bags for reinfusion purposes. Hemorrhagic shock was maintained for 90 min [14].
After this period, the animals were resuscitated in accordance with established trauma guidelines (ATLS® & AWMF-S3 guideline on Treatment of Patients with Severe and Multiple Injuries®) [16]. The animals were rewarmed using a forced-air warming system until normothermia (38.7–39.8 °C) was reached [16]. In addition to crystalloids (SterofundinISO and pediatric electrolyte solution 2 ml/kg BW/h), the pigs received previously withdrawn blood to restore hemostasis. The animals were mechanically ventilated and monitored in a special intensive care unit (ICU) for 72 h post-injury according to well-established ICU treatment guidelines. Antibiotics (Ceftriaxon® 2 g, i.v.) were administered before surgery and then every 24 h until the end of the experiment.
Sampling
Muscle samples from the vastus lateralis muscle were taken clockwise at equal intervals in the area of the femoral fracture (traumatic [T]-side). Muscle samples were also taken from the contralateral femur from identical parts of the lateral vastus muscle (atraumatic [AT] side). Muscle samples of approximately 1 cm × 0.5 cm fixed in 4% formaldehyde for 24 h before embedding into paraffin blocks.
Naphthol A-SD-chloroacetate esterase staining (CAE) histology
Sections (5–10 µm thick) of the muscle preparations were histologically stained with CAE stains to visualize PMNL that had migrated into the tissue. The paraffin-embedded tissue was deparaffinized using xylene (8 min), 100% ethanol (EtOH; 3 × 3 min), 95% EtOH (2 × 3 min), 70% EtOH (2 × 3 min) and phosphate buffered saline (PBS; 1 × 5 min). Solution 1 contained 5 ml PBS,12.5 µl 4 % sodium nitrite, and 12.5 µl New Fuchsin. Solution 2 contained 225 µl naphthol-AS-D chloroacetate in 5 ml PBS. The final stain contained 25 µl of solution 1 and 5 ml of solution 2.
The excess PBS on the slides with the samples was allowed to dry and the chloroacetate solution was added dropwise and the slides were incubated at room temperature (RT) for 45 min.
As a contrast stain, the slides were washed in PBS for 3 min and stained with Harris hematoxylin solution for 30–60 s and then immersed in 5× saturated lithium carbonate solution, followed by washing with distilled water. The slides were dehydrated in 70% EtOH, 95% EtOH, 100% EtOH, and xylene for 10 short washing steps each and then covered with Permount mounting medium.
PMNL scoring of muscle tissue
The average value of the cells identified as PMNL in a field of view (0.196 mm2) at 400× magnification was chosen for scoring. Here, the important factors were to differentiate between the signal strengths of the different cell types and to count only strongly stained cells as PMNL. The PMNL count was averaged over 6 fields of view for each sample. This classification is also called “neutrophils per field of view” or the high power field (N/HPF) score. According to the guidelines of the Musculoskeletal Infection Society (MSIS), scorings of more than 5 N/HPF are considered to represent a strong inflammatory reaction [142]. Scoring was performed by investigators JG and ZQ.
Evaluation of the “Monotrauma” groups by qRT-PCR
Concomitant injuries are known to affect cytokine transcription at the fracture site [17, 18]; therefore, our aim was to independently evaluate the influence of the fracture fixation strategy (nailing vs. external fixation) on the muscular transcription level of pro-inflammatory cytokines (IL-6 and IL-8). Therefore, qRT-PCR was performed only for muscle tissues subjected to monotrauma (Table 1).
Table 1 PCR primers (in the 5’ – 3’ direction) The PCR was run with the specified primers on a StepOne Plus RT device (Table 8) under the following protocol
Primer
|
Sequence 5‘-3‘
|
Sus scrofa domesticus
|
|
β-Actin forward
|
GGACTTCGAGCAGGAGATGG
|
β-Actin reverse
|
GCACCGTGTTGGCGTAGAGG
|
RSP 18 forward
|
GGGTGTAGGACGGAGATAT
|
RSP 18 reverse
|
ATTACACGTTCCACCTCATC
|
HPRT forward
|
GTCAAGCAGCATAATCCAAAG
|
HPRT reverse
|
AAGGGCATAGCCTACCACAA
|
PPIA forward
|
AGCACTGGGGAGAAAGGATT
|
PPIA reverse
|
AAAACTGGGAACCGTTTG
|
Interleukin 6 forward
|
GAATCCAGACAAAGCCACCA
|
Interleukin 6 reverse
|
GTGCCCCAGCTACATTATCC
|
Interleukin 8 forward
|
ACTGCTGTTGTTGTTGCTTC
|
Interleukin 8 reverse
|
ATATCTGTACAACCTTCTGC
|
Statistics testing
First the obtained results were tested for normal distribution using the Kolmogorov-Smirnov test. Based on the not normally distributed values and the group size the Wilcoxon-Mann-Whitney test method was used for further calculation of the significance. The statistical significance was set at an error probability of p = 0.05 or α = 5%.
The calculated data was analyzed using SPSS and Microsoft Excel.