Cell culture
The human GC lines (SGC7901, BGC823, MGC803, MNK45 and AGS) were taken from Central South University Xiangya School of Medicine Affiliated Haikou Hospital. GC cells were maintained in RPMI-1640 medium (BI, China) with 10% fetal bovine serum (FBS, BI). GC cells were cultured in a cell incubator with 5% CO2, at 37 ℃.
Transfection
For knocking down XAGE-1b, lentivirus with a shRNA vector (5′-GCTGCATCAGTCAAACACC -3′) was designed in Jikai (Shanghai, China). The shRNA vector targeting XAGE-1b was transfected into HEK293T cells. Then, 1 ml viral supernatant with 4ul of polybrene was added into GC cells for stable transduction. After that, the medium was replaced by the complete culture medium with 10% FBS.
GC tissues and Tissue RNA extraction
The total of 60 pairs of fresh GC tissues and normal mucosa samples were collected from Central South University Xiangya School of Medicine Affiliated Haikou Hospital. The Biomedical Ethics Committee of Haikou People’s Hospital and the Research Ethics Committee of Zunyi Medical University approved the study. Written informed consent was acquired from the GC patients.
The cleaned mortars were placed in 180 ℃ oven and baked for 5 hours. The mung bean sized fresh tissues were put into a mortar with appropriate liquid nitrogen, grinded into powder. Then, 1 ml Trizol was added into the mortar for homogenate cracking.
Real time RT-PCR
Trizol reagent (Invitrogen, USA) was used to extract RNA and cDNA was synthesized according to the instructions for Takara reverse kit (TaKaRa, China). Primer sequences of XAGE-1b were obtained from PCR Primer 5.0 software. The specific sequences of primers were as follows: XAGE-1b (upstream-primer: 5’AAACCAGCTTGCGTTGTTTCAG3’; downstream-primers:5’CGCA
TGTTCACTGGGCGTCTT3’). The reaction system of reverse transcription was prepared following the instructions of Takara RT-PCR kit. Relative expression quantity between the experimental group and the control group was represented by folders = 2-ΔΔCT. The experiment was repeated three times.
Cell proliferation assay
CCK8 assay kit (C0038, Beyotime, China) was used to detect cell proliferation. 1×103 GC cells with 100 μl culture medium were seeded into 96-well plates. The proliferation assay was performed by adding 10 μl CCK8 reagent into wells for incubation 2 h and measured continuously for 7 days respectively. The absorbance (OD) value of each pore at 450 nm was measured. The experiment was repeated three times.
In vitro invasion assay
Invasion Boyden Chamber (BD Biosciences, Foster city, USA) plated by matrigel was used to detect cell invasion. The complete culture medium was added into the lower chamber as the chemotactic factor. In each chamber, 2×105 cells with serum-free RPMI 1640 medium were added into the upper compartment. After incubation for 48 h, the chambers were fixed with alcohol and stained with hematoxylin. The number of cells passed through the membrane with matrigel was examined by the microscope in 5 random visual fields and counted the average number of cells. The experiment was repeated three times.
Metastasis in the mouse models
For tail vein metastasis assay, a total of 1×106 cells were injected into the tail veins of nude mice. After 8 weeks, the nude mice were killed, and lungs were removed for further analysis. The lung tissues were fixed, dehydrated, embedded, sectioned and subjected to pathological observation by the microscope. Metastatic tumors were observed by H&E staining and the number of metastasis was assessed by counting metastatic lesions in each tissue section.
Bioinformatic analyses based on online databases
The samples diagnosed with GC were from the TCGA database (http://cancergenome.nih.gov/) and were used to analyze the differential expression of XAGE-1b, CLDN6 and CHGA. Survival analysis was conducted based on the expression value of the genes and follow-up time of the GC patients. The expression correlation of XAGE-1b, CLDN6 and CHGA in GC was analyzed by GEPIA (http://gepia.cancer-pku.cn/detail.php?clicktag=matrix).
Statistical analysis
The Graphpad Prism 6.0 was used to analyze data. Mean ± SD was used to express the experimental data. P < 0.05 was regarded as statistical difference. Statistical analysis methods included independent samples t-test, one-way ANOVA, two-way ANOVA and Mantel-Cox test.