Patients
This study was approved by the local ethics committee (No. IR.TBZMED.REC.1400.047) of the Tabriz University of Medical Sciences, Iran. A total of 20 patients (female = 10, male = 10) with COVID-19 pneumonia, mean age 45.4 ± 4.8 years old, were recruited, and the peripheral blood sample was obtained from each patient after written informed consent. The COVID-19 diagnosis was confirmed based on laboratory findings, a real-time reverse-transcriptase-polymerase-chain-reaction assay of nasal or pharyngeal swab specimens for SARS-CoV-2, and ultrasound imaging. All participants were free from any current anti-inflammatory pharmaceuticals or immunosuppressants, known HIV infection, and had not taken vitamin supplements one month before the study. The information about subject and evaluated clinical and laboratory parameters are summarized in Table 1.
Table 1
Subjects clinical and laboratory information
Patients (n = 20) clinical information
|
Patients (n = 20) clinical information
|
Age, Years
|
19–69 (53.3 ± 8.4)
|
White blood cell count, × 109/L
< 4
4–10
> 10
|
4 (20%)
10 (50%)
6 (30%)
|
Sex
Men
Women
|
10 (50%)
10 (50%)
|
Lymphocyte count, × 109/L
< 1·0
≥ 1·0
|
12 (60%)
8 (30%)
|
Current smoking
|
4 (20%)
|
Platelet count, × 109/L
< 100
≥ 100
|
9 (45%)
11 (55%)
|
Diabetes
|
1 (5%)
|
Creatinine, µmol/L
≤ 133
> 133
|
18 (90%)
2 (10%)
|
Hypertension
|
1 (5%)
|
Lactate dehydrogenase, U/L
≤ 245
> 245
|
14 (70%)
6 (30%)
|
Cardiovascular disease
|
2 (10%)
|
Bilateral involvement of chest radiographs
|
20 (100%)
|
Chronic kidney disease
|
0
|
White blood cell count, × 109/L
< 4
4–10
> 10
|
4 (20%)
10 (50%)
6 (30%)
|
Fever
< 37.3 °C
37.3–38.0 °C
38.1–39.0 °C
> 39.0 °C
|
2 (10%)
8(40%)
7 (35%)
3 (15%)
|
Lymphocyte count, × 109/L
< 1·0
≥ 1·0
|
12 (60%)
8 (30%)
|
Cough
|
11 (55%)
|
Platelet count, × 109/L
< 100
≥ 100
|
9 (45%)
11 (55%)
|
Headache
|
4 (20%)
|
|
|
Dyspnea
|
6 (30%)
|
|
|
Peripheral blood mononuclear cell (PBMC) preparation and cell culture
PBMCs were separated from fresh blood samples collected in EDTA tubes using Ficoll density gradient centrifugation (d = 1077g/mL; lymphosep, Biosera, UK). PBMCs were collected and washed twice with phosphate-buffered saline (PBS) solution(Sigma-Aldrich, Schnelldorf, Germany) and centrifuged for 15 min at 400 g. The mean number of 1.18×106 ± 0.12 PBMCs were isolated per ml of whole blood. The blood mononuclear cells were then resuspended 1:1 in PBS solution.
Co-culture of PBMCs with MSCs
Before co-culture, commercially available human bone marrow MSCs (Royan, Iran) were seeded into each well of a 6-well flat-bottom culture plate (5 × 104 cells/well) and cultured in 2 ml of RPMI-1640 medium (Invitrogen, Grand Island, NY, USA) supplemented with 10% FBS (fetal bovine serum, Invitrogen), 2 mM glutamine, 100 U/ml penicillin and streptomycin. After 6 hour cell adhesion at 37°C and 5% carbon dioxide incubator, the PBMC (1×106) from COVID-19 patients were loaded onto the plated MSCs. PBMCs and cultured MSCs were co-cultured for 72h in a medium containing RPMI 1640, supplemented with 10% FBS, 1% L-glutamine, and 1% penicillin-streptomycin. The ratio of MSCs to PBMC was 1:10 to investigate the MSC-mediated effects. PBMCs cultured without MSC served as control. After the co-culture for 3 days, the suspended PBMCs and cell-free supernatants were collected separately and kept frozen until further analysis. The effects of MSCs were evaluated by fluorescence-activated cell sorting (FACS) for immunophenotype of PBMCs, enzyme-linked immunosorbent assay (ELISA), and real-time polymerase chain reaction (rt-PCR) for cytokine expression.
Cytokine quantification in the supernatants of PBMCs
The concentrations of anti-inflammatory (IL-4) and pro-inflammatory (IL-1β, IL-6, IL-18, TNF, and IFN-γ) cytokines were measured in media collected from PBMC cultures before as well as after exposure to MSCs by ELISA assay using the kit (MyBio-Source) according to the manufacturer's instructions.
RNA isolation and complementary DNA synthesis
The samples were processed to determine the mRNA levels of Th1/Th2 cytokines and related genes, including T-bet and GATA-3. According to manufacturer method protocol, total cellular RNA was extracted from cultured peripheral blood cells and PBMCs from COVID-19 patients without administration of MSCs using Qiagen's RNeasy Mini Kit (SinaClon),) used in RT-PCR. For comparison, RNA extracted from untreated cells was used as a control. RNA was then reverse transcribed to complementary DNA synthesis for the amplification using complementary DNA synthesis kits (Thermo Fisher Scientific).
Real-time quantitative polymerase chain reaction
The expression of 8 genes involved in the inflammatory pathways was profiled. The purity of extracted RNA was estimated by UV spectrophotometer to determine A260/280 and A260/230 ratios. Quantitative analysis of mRNA expression was performed by SYBR green real-time PCR assay, and the LightCycler™ real-time PCR instrument (Roche Molecular Biochemicals) was used to detect the fluorescence. cDNA (5 µl) was added to each well of a 96-well plate, in a total of 10µl reaction mixture that contained 8µl of SYBR Green and 0.5µM of primers. A melt curve was performed at the end of the PCR. The specific primers used were as presented in Table 2. As a housekeeping gene, β-Actin was used as an internal control, and the amount of all mRNA targets in test samples were normalized to the corresponding β‐Actin transcript. The PCR reaction was set up in duplicate for each sample. The sequences of primers have been listed in Table 2.
Table 2
Gene
|
Primer
|
Sequence
|
IL-1
|
Forward
|
ACGATGCACCTGTACGATCA
|
Reverse
|
TCTTTCAACACGCAGGACAG
|
IL-6
|
Forward
|
ACTCACCTCTTCAGAACGAATTG
|
Reverse
|
CCATCTTTGGAAGGTTCAGGTTG
|
IL-4
|
Forward
|
CCGTAACAGACATCTTTGCTGCC
|
Reverse
|
GAGTGTCCTTCTCATGGTGGCT
|
IL-18
|
Forward
|
GATAGCCAGCCTAGAGGTATGG
|
Reverse
|
CCTTGATGTTATCAGGAGGATTCA
|
TNF-α
|
Forward
|
CAGAGGGAAGAGTTCCCCAG
|
Reverse
|
CCTTGGTCTGGTAGGAGACG
|
IFN-γ
|
Forward
|
GAGTGTGGAGACCATCAAGGAAG
|
Reverse
|
TGCTTTGCGTTGGACATTCAAGTC
|
T- bet
|
Forward
|
CAACAACCCCTTTGCCAAAG
|
Reverse
|
TCCCCCAAGCAGTTGACAGT
|
GATA-3
|
Forward
|
ACCACAACCACACTCTGGAGGA
|
Reverse
|
TCGGTTTCTGGTCTGGATGCCT
|
β-actin
|
Forward
|
AGAGCTACGAGCTGCCTGAC
|
Reverse
|
AGCACTGTGTTGGCGTACAG
|
(Abbreviation: IL-1β: Interleukin-1 β; IL-6: Interleukin-6; IL-18: Interleukin-18; TNF-α: tumor necrosis factor-alpha) |
Flow cytometry analysis
After being cultured with MSCs in vitro and before the experiments, the percentages of CD4 + IFNγ + Th1 and CD4 + IL-4 + Th2 cells were assessed in PBMCs by flow cytometry. 5 x 106 of PBMCs were washed with PBS followed by a 5-h incubation with phorbol-12-myristate-13-acetate (PMA) (50 ng/mL) plus ionomycin (0.5mM) at 37°C in a 5% CO2 humidified incubator. The cells were stimulated with monensin as a chemical stimulator and stained with fluorescence-labeled antibodies against the surface and intracellular markers. The mean fluorescence intensity was measured by FACS and analyzed by Flowjo software.
DNA bisulfite treatment and methylation-specific PCR (MSP)
We next profiled DNA methylation of the 8 immune response-related loci in PBMCs of the two groups. Genomic DNA was extracted from the PBMCs by the ???? kit (Company???) as per the manufacturer's instructions. Total genomic DNA isolated from PBMCs prior to and following MSC was modified by bisulfite treatment, and MSP was conducted to explore the methylation status of the candidate genes at the promoter in PBMCs. Basically, bisulfite conversion of DNA leads to the change of un-methylated cytosine residues to uracil residues, whereas the methylated cytosine is unchanged [24]. According to the standard protocol, the first step, sodium bisulfite treatment of the DNA, was carried out using the Zymo EZ-DNA Methylation Kit. As details, sample DNA (10 µl; 1 µg/µl) and distilled water (35 µl) were added into the tubes. NaOH 2 M (5 µl) was added and mixed well and then incubated for 20 min in 37°C. Hydroquinone (C6H6O2, 30 µl; 100 mM) was added, and the solution pipetted until the color of the content changed into light yellow. After that, sodium bisulfite (NaHSO3, 3 M; 520 µl) was added to it and incubated for 16 h in 50°C water bath. The DNA from the samples was extracted using a DNA extraction kit (Roche, Germany) according to the instruction used for subsequent PCR analysis. The amplification reaction was performed as the following: 1.5 µl of each forward and reverse primer, 4 µl of bisulfite-treated DNA, and 10 µL of PCR master mix with nuclease‐free water to make a total volume of 25 µl. To verify amplification validation, the PCR product from each sample was gel electrophoresed and sequenced.
Statistics
Data were analyzed using SPSS 20.0 and GraphPad Prism 5. The repeated measure ANOVA was employed to assess the main effects of time × treatment interaction. Independent t-test analysis compared the changes in the measurements between the groups. Parametric data expressed as mean ± the standard deviation and statistical significance were defined at p < 0.05.