Plant material and in vitro culture establishment
For this study, two individuals of P. canescens originating from a unique grey poplar population located in Dyjákovice village in the Czech Republic were selected as source trees. Branches were collected in March 2016 and immediately stored in a container at 4°C. Twigs with dormant axillary buds were rinsed with running tap water for 30 min, surface disinfected with 1% sodium hypochlorite (v/v) for 20 min, 50% Korsolex plus (v/v) for 20 min, sterile distilled water for 20 min, and 1% HgCl2 (w/v) for 20 min and finally rinsed three times with sterile distilled water for 15 min. The sterile dormant buds were then placed into glass jars containing 50 ml modified agar MS medium (Murashige and Skoog, 1962) supplemented with 10 mg l-1 glutamine, 2 mg l-1 glycine, 0.1 mg l-1 indole-3-butyric acid (IBA), 0.2 mg l-1 6-benzylaminopurine (BAP), 30 g l-1 sucrose, and 6 g l-1 agar at a pH of 5.8 for the induction of organogenesis. Explants were grown under controlled conditions at a photon flux density of 30 µmol m-2.s-1 (16/8 day/night period) at 21°C for 30 days. Once shoots had elongated from axillary buds, they were excised and transferred for multiplication into the same modified MS agar medium used for induction. Explants were cultured in glass jars as previously described. The shoots were subcultured every four weeks.
Root induction and acclimatization
The single grey poplar shoots were individually rooted on MS medium that did not contain any growth regulators for the induction of rhizogenesis. In total, each genotype was represented by 25 explants for the experiment. After four weeks, the rooted shoots were transferred into perlite at temperature 22±2°C for 14 days for acclimatization. High humidity was maintained by covering the pots with plastic sheets. The plants were watered with 1/10 strength MS medium. After acclimatization, fourteen-day-old poplar plantlets were treated with 10 µM or 100 µM CdCl2. A concentration of 100 µM Cd was chosen to provoke a fast response to stressful conditions. Untreated plants were used as a control. Samples were collected 2 and 10 days after treatment for all analyses and measurements.
DNA extraction, PCR and genotyping
DNA was extracted from 20 mg of lyophilized leaves from source trees (TP11 and TP20) using a DNeasy Plant Mini Kit (Qiagen, USA) with the protocol provided by the manufacturer. The concentration and purity of DNA was determined using a NanoPhotometer (Implen, Germany). DNA was stored at 4°C.
For polymerase chain reactions (PCRs), fifteen nuclear microsatellite loci, WPMS5, WPMS15, WPMS16, WPMS18, WPMS19, WPMS20, ORPM14, ORPM16, ORPM20, ORPM30, ORPM60, ORPM127, ORPM193, ORPM220 and ORPM312, were used that were formerly described by [73–77]. The PCR programme, conditions and multiplex arrangement were performed according to Pokorna et al. [78]. Reactions were performed in a Veriti Thermal cycler programmed for an initial melting at 94°C for 3 min followed by 35 cycles at 94°C for 45 s and 55°C for 45 s. A final extension step at 72°C for 20 min was performed. Then, 1 µl of PCR product was mixed with 0.4 µl of Gene ScanTM – 600 LIZ® internal size standard (Applied Biosystems, USA) and 11 µl of formamide (Hi-DiTM Formamide, Applied Biosystems). After denaturation at 94°C for 3 min and immediate chilling on ice, the products were analysed with capillary gel electrophoresis using a genetic analyser 3500 (Applied Biosystems, USA). The detection of the PCR product was enabled by the fluorescent label attached to the 5´end of the forward primer. Allele calling was performed using GeneMapper® 4.1 software provided by Applied Biosystems. Allele binning was performed manually after plotting the fragment size distribution for each locus [79].
RNA extraction and cDNA synthesis
Total RNA was extracted from mature grey poplar plants (control, 10 and 100 µM Cd), stressed roots and shoots were collected separately from three different plantlets at the end of days 2 and 10. Roots and shoots were frozen in liquid nitrogen and stored at -80°C until analysis. RNA was extracted from homogenized plant material (approximately 100 mg of fresh weight) using the RNeasy Plant Mini Kit (Qiagen, Germany) according to the manufacturer´s instructions. RNA concentration was measured by the MaestroNano Pro (MaestroGen). Extracted RNA (2 µg) was reverse transcribed by M-MLV Reverse Transcriptase (Promega, USA), while oligodT primers were used for first-strand cDNA synthesis for each sample. According to the manufacturer´s protocol, RNA templates with primers were preincubated for 5 min at 75°C and immediately cooled on ice. The RT-PCR premix was then added, and the transcription reaction was run at 42°C/60 min, 70°C/5 min, and 10°C until further manipulation.
Gene expression analysis
The quantitative real-time RT-PCR analyses were carried out using GoTaq qPCR Master Mix (Promega) mix in a LightCycler 96 (Roche, Germany). The analyses were performed using two reference genes and seven target genes reported previously for poplar trees (Table 6). The primers were designed using Primer3 software (Rozen and Skaletsky 2000) according to the following parameters: 100-200 bp product size, 19-22 bp primer length, 58-60°C melting temperature (Tm) and 45-55% GC content. The thermal cycling conditions were assessed 120 s at 95°C for preincubation, followed by amplification for 45 cycles of 95°C for 10 s, 60°C for 10 s, 72°C for 10 s, melting curve was assessed at 95°C for 10 s, followed by 65°C for 60 s and 97°C for 1 s. Analysis of all samples was performed with three technical replicates. Quantifications were performed according to the ∆Ct method, and the relative gene expression levels were normalized by the expression levels of the 18S ribosomal RNA and elongation factor 1-α genes, as internal standards [80].
Table 6: The gene name, accession number, description, primer sequence and reference
Gene
|
Accession number
|
Gene description
|
Primer Sequence (5´- 3´)
|
Reference
|
LOC112328551
|
XR_002983567
|
18S Ribosomal RNA
|
F: AGAAACGGCTACCACATCCAA
R: CCAGACTTGCCCTCCAATGG
|
Brentner et al. [81]
|
LOC18109220
|
EF147878.1
|
Elongation factor 1-α
|
F: CCACACCTGTCACATTGCTG
R: ACCAGCATCACCGTTCTTCAG
|
Basa et al. [82]
|
LOC7470435
|
XM_002306184.3
|
Endochitinase 2
|
F: TACGGGCAATGTGGAAAAGC
R: ATTGTGGCATGAGGGCTTTG
|
Kieffer et al. [83]
|
OPR1
|
NM_106318.4
|
12-Oxophytodienoate reductase 1
|
F: CGGACAAGCAGGAGACTCAAA
R: CCACCGTCTTCATTCTTGGC
|
Brentner et al. [81]
|
UGT74E2
|
NM_100448.4
|
Uridine diphosphate glycosyltransferase 74E2
|
F: CACAAATCCGTGGGATGCTT
R: TCTGTCCACTGTGGCATTGC
|
Brentner et al. [81]
|
LOC105129022
|
XM_011030918
|
Thaumatin-like protein
|
F: ACCACACAAGCACGCATTTG
R: TGAACCATAGCCTTGGCATG
|
Kieffer et al. [83]
|
LOC18095761
|
18095761
|
Photosystem II 10 kDa polypeptide
|
F: ATGGTGCTAATGTGGATGGC
R: AACAGCCCAGATTAGCAAGC
|
He et al. [84]
|
MT2a
|
AY594297.1
|
Metallothionein 2a
|
F: ATCATCGCATCGACGGATTG
R: CCAGAGCTGCAAATCCAAGAAG
|
Kohler et al. [85]
|
GSTF4
|
GQ377243.1
|
Phi class glutathione S-transferase
|
F: CTTAGCCTCGTTTTCCTCCA
R: CTTAGCCTCGTTTTCCTCCA
|
Gaudet et al. [86]
|
Measurement of Cd and selected element contents
The content of Cd and selected minerals (K, Ca, Mg, Zn) in the roots and shoots of grey poplar samples was determined using ICP-OES (Inductively Coupled Plasma Optical Emission Spectrometry). Dried material was milled to fine powder, whereas each sample (100 mg fresh weight) was mineralized with 5 ml of nitric acid [67% HNO3 (w/v)] and 1 ml of hydrogen peroxide [30% H2O2 (w/v)] in a microwave digestion system (Speedwave4, Berghof, Germany) at 200°C for 15 min. Cooled samples were diluted with distilled water, and the element content was determined by ICP-OES (Varian 725-ES, Agilent Technologies, USA). Three biological replicates of control and Cd-treated plants were analysed in two individual sets of experiments.
Chlorophyll measurement
Fresh shoot tissues (100 mg) were extracted in 80% acetone (w/v 1 g FW 20 ml-1) and centrifuged for 14 000 rcf for 5 min at 4°C. The supernatant was separated, and 0.2 ml of the supernatant was mixed with 0.8 ml of acetone. The solution mixture was analysed for chlorophyll a, chlorophyll b and chlorophyll a+b contents by recording the absorbance at 663 (chlorophyll a) and 647 (chlorophyll b) using a UV-VIS spectrophotometer (VIS-7236, Rayleigh). The contents of photosynthetic pigments were calculated according to Sumanta et al. [87].
Autoradiography method
The grey poplar plantlets (genotypes TP11 and TP20) were transferred from in vitro conditions to greenhouse and cultivated in the modified Hoagland medium (Hoagland and Arnon, 1938). The hydroponic medium with a pH adjusted to 5.0 contained 4 mM CaCl2, 2 mM K2SO4, 2 mM NH4NO3, 2 mM NaH2PO4, 1.5 mM MgSO4, 4 mM NaNO3, 4 mM NH4Cl, 0.2 mM FeSO4, 138.8 µM H3BO3, 20.8 µM MnSO4, 2.3 µM ZnSO4, 3.3 µM CuSO4 and 0.2 µM Na2MoO4 (PENTA Ltd., Czech Republic). The plants were maintained at 23 °C with a relative humidity of approximately 60% and were irradiated with 16 h of light (average irradiation of 72 µmol.m-2.s-1 - at the plant surface, with horizontal differences in irradiation less than 20%, sodium discharge lamps at 400 W, Thorn Radbay, UK). Two-week-old plants were used for the experiments.
For the experiment the modified Hoagland medium contain 0.01 or 0.1 mM Cd(NO3)2 x 4H2O (PENTA Ltd., Czech Republic) and volume activity of 6.517 MBq/L of 109Cd as CdCl2 in HCl water solution (3g HCl/L) (specific activity 4.591 MBq/g, EUROSTANDARD CZ Ltd., Czech Republic) was used. After exposure (2 and 10 days), the roots of the plants were washed with distilled water, EDTA (concentration 0.1 mM) and distilled water and then the plants were pressed and dried (between two filter papers, 25 °C, ca 1 week). The pressed plants were transferred to an Exposure Cassette (Amersham Biosciences, USA) (24 x 30 cm) and put on the Kodak Storage Phosphor Screen S 230. The screen was exposed during 120 hours (2 days Cd treatment) or 24 hours (10 days Cd treatment) and scanned by Typhoon Imager (Amersham Biosciences, USA). The data were visualized by program Image Quant TL.
Data analysis
All analyses were performed in three biological replicates using two-way ANOVA and Tukey´s test (Minitab) to evaluate the significant differences (P < 0.05) among the Cd treatments (0 µM, 10 µM and 100 µM).