Antisense RNA Enhanced Sensitivity of Methicillin-resistant Staphylococcus Aureus to Hydrogen Peroxide

doi:10.21203/rs.3.rs-486900/v1

Download PDF

Research article

Antisense RNA Enhanced Sensitivity of Methicillin-resistant Staphylococcus Aureus to Hydrogen Peroxide

https://doi.org/10.21203/rs.3.rs-486900/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Staphylococcus aureus (S. aureus) is the leading cause of various infective diseases including topical soft tissue infections. Due to an increasing prevalence of the methicillin-resistant Staphylococcus aureus (MRSA), S. aureus infection become more challenging to being treated over recent years. The goals of this study were to investigate the roles of antisense yycF/G RNAs in the regulation of the biofilm formation and pathogenicity. Methods: MRSA ASyycF/G overexpression mutants were constructed. The biofilm biomass was determined by crystal violet microtiter assay and scanning electron mi-ceroscopy (SEM). Quantitative RT-PCR and western blotting analysis were used to detect the transcripts and translations of biofilm-related genes. The effects of the antisense RNAs (ASyycF/G) strategy on the susceptibility of biofilm-producing S. aureus to hydrogen peroxide were also investigated. Result: The ASyycF/G transcript leaded to reduction in the biofilm formation. Overexpression of ASyycF/G inhibited the transcripts and translations of biofilm-related genes. The sensibility to vancomycin was improved in ASyycF/G overexpression MRSA. Conclusions: The biofilm biomass and the transcripts of the pathogenicity associated genes decreased in the ASyycF/G overexpression mutant. Thus, the current evidence may provide a supplementary strategy for managing MRSA infections.

Orthopedics

Orthopedic Surgery

Antisense

Biofilm formation

Staphylococcus aureus

YycFG

Staphylococcus aureus (S. aureus), as Gram-positive opportunistic pathogen, is the leading cause of various infective diseases including topical soft tissue infections, osteomyelitis, and even high mortality endocarditis [1]. Due to an increasing prevalence of multi-resistant strains such as methicillin-resistant Staphylococcus aureus (MRSA), S. aureus infection become more challenging to being treated over recent years [2]. Biofilm formation of MRSA is responsible for persistent infections and difficult to being eradicated as biofilm conditions which is much more resistant to environmental stimulus. Hydrogen peroxide (H₂O₂), as a common biocide, is used for cleaning and debriding chronic wound infections. However, the activity of H₂O₂ is significant decreased in against biofilm with drug resistant bacteria. Thus, targeting biofilm has become an alternative strategy to attenuate the pathogenicity of bacterium.

In bacteria, two-component signal transduction systems (TCSs) play an essential activity on adaptation to environment changes [3]. In S. aureus, 16 TCSs including the only essential YycFG are encoded contribute to the pathogenicity and virulence [4–5]. Commonly YycFG the only essential TCS also known VicRK/WalRK TCS was consisting of a sensor histidine protein kinase YycG and its cognate response regulator YycF [6–7]. Our previous study showed YycFG could modulate extracellular polysaccharide (EPS) synthesis via ica operon, which is associated with biofilm construction [7]. Hence, YycFG TCS represents a promising target to modulate S. aureus biofilm.

An antisense oligonucleotide can hybridize to the target mRNA by base-pairing recognition [9]. It can inhibit translation of the corresponding gene by targeting sequences within pre-mRNA as a kind of antimicrobial oligonucleotides to co-administered with biocides [9–10]. The yycF gene, as the first gene of yycFG operon [11], encodes YycF response regulator. From this point we designed an antisense yycF (ASyycF) according to yycF sequence to inhibit the expression of yycF, which has a positive association with ica expression [7]. We hypothesis this ASyycF could enhance H₂O₂ bactericide effect on methicillin-resistant S. aureus by depression the construction of ica-dependent biofilm as a novel antimicrobial agent for infection elimination.

Bacterial strains and biofilms growth conditions

Methicillin-resistant S. aureus strain ATCC43300 provided by the Department of Laboratory Medicine (West China Hospital, Sichuan University, Chengdu, China) was cultured in tryptic soy broth (TSB). After overnight incubation at (37ºC, 5% CO₂). Five hundred microfilters of S. aureus overnight suspension was inoculated into 10 mL fresh TSB medium to mid-logarithmic phase with OD₆₀₀ value at 0.5. For the formation of biofilm, the sterilized glass disks (diameter in 14 mm) were applied for 24 hours biofilms for further analyses according to our previous study [12].

Construction of S. aureus antisense yycF/yycG overexpression strains

Recombination of plasmid pDL278 containing antisense yycF or yycG was conducted by inserting antisense yycF (ASyycF) or yycG (ASyycG) sequence into restriction sites between BamHI and EcoRI by Sangon Biotech (Shanghai, China). According to our previous study, an ASyycF overexpression methicillin-resistant S. aureus (ASyycG mutants) or an ASyycG overexpression methicillin-resistant S. aureus (ASyycF mutants) was constructed by adding recombinant pDL278 ASyycG or ASyycF plasmid. The empty pDL278 plasmid did not exert any effects on the viability of S. aureus [12].

Analysis of gene expression using quantitative real-time PCR (qRT-PCR)

MRSA, ASyycG and ASyycF strains were cultured to the midlogarithmic phase. Then, we treated the S. aureus planktonic cultures with 100mM H₂O₂ for 60 min, washed and resuspended in PBS (pH 7.2). The total RNAs were extracted and purified with the MasterPureTM RNA Purification Kit (Epicentre Technologies, Epicentre, Madison, WI, USA) including MRSA + H₂O₂ group, ASyycG + H₂O₂ group, and ASyycF + H₂O₂ group. The purified RNA was reverse transcribed to cDNA with the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific). The quantitative real-time PCR assays were applied with LightCycler 480 system (Roche, Basel, Switzerland) with the primers listed in Table 1 with the 16Sr RNA gene as an internal control. Each sample was analyzed in triplicate, and the threshold cycle values (CT) were quantified [7].

Table 1

Sequences of primers in this study
Primers	sequence 5’-3’ (Forward/Reverse)
RT-qPCR
icaA	5’- GATTATGTAATGTGCTTGGA − 3’/ 5’- ACTACTGCTGCGTTAATAAT − 3’
yycF	5’ - TGGCGAAAGAAGACATCA − 3’/ 5’ – AACCCGTTACAAATCCTG- 3’
yycG	5’ - CGGGGCGTTCAAAAGACTTT − 3’/ 5’ - TCTGAACCTTTGAACACACGT − 3’
icaD	5’ - ATGGTCAAGCCCAGACAGAG-3’/ 5’ –CGTGTTTTCAACATTTAATGCAA − 3’
16S rRNA	5’ - GTAGGTGGCAAGCGTTATCC − 3’/ 5’ –CGCACATCAGCGTCAACA-3’

Western Blotting

For protein extraction, the bacterial cells including MRSA + H₂O₂ _group, ASyycG + H₂O₂ group, and ASyycF + H₂O₂ group were mechanically disrupted and collected by centrifugation as previously described [12]. For western blot analysis, the collected protein was probed with purified YycG- and YycF- specific antibodies (1:1000, HuaBio Biotechnology, Hangzhou, China). A BioRad GS-700 Imaging Densitometer was used to determine the signal density of Western blot bands for comparation.

Biofilms exposure to hydrogen peroxide

To determine the susceptibility of S. aureus ATCC43300, ASyycG mutants and ASyycF mutants to oxidants in biofilms conditions, all groups were treated with 3% H₂O₂ (for clinical irrigation, H₂O₂ is usually 3%) for 30 min at 37°C. Residual H₂O₂ was removed by diluting biofilms samples in PBS buffer. The treated biofilms samples were cultured in TSB medium for another 24 hours for further investigation, including MRSA + H₂O₂ group, ASyycG + H₂O₂ group, and ASyycF + H₂O₂ group.

The microtiter dish assay and epifluorescence staining for biofilm biomass

The microtiter dish assay was applied to evaluate the biomass of treated biofilm after cultured with another 24 hours with crystal violet (CV) following previous protocol [12]. The dye bound to the biofilms was transferred into a new plate and the absorbance was measured with a microplate reader (ELX800, Gene) under OD₆₀₀ nm.

For epifluorescence staining, the biofilms were labeled with SYTO9 (LIVE/DEAD Bacterial Viability Kit reagent; BacLight, Invitrogen, Grand Island, NY, USA); live cells were stained green, while dead cells appeared red. The cells were visualized using epifluorescence microscopy (Nikon Eclipse TE-2000S, Melville, NY) at 40×magnification. Notably, three random fields in each specimen were selected.

Characterizing biofilm morphologies

The 24 hours biofilms of MRSA + H₂O₂ group, ASyycG + H₂O₂ group, and ASyycF + H₂O₂ group were labeled with SYTO9 (Invitrogen; Thermo Fisher Scientific, Inc.). The observation was implemented using epifluorescence microscopy (Nikon Eclipse TE-2000S, Melville, NY) at 40 ×magnification. Notably, five random fields in each specimen were selected. To assess the structure of biofilms, the scanning electron microscopy (Inspect, Hillsboro, OR, USA; SEM) was conducted. Briefly, the treated biofilm samples were diluted twice using PBS and fixed with 2.5% glutaraldehyde for 4 hours. Then the fixed samples were serially dehydrated and dried using a critical point dryer. After coated with gold powder, the micrographs of biofilm samples were evaluated.

Data analysis

All statistical data were analyzed in SPSS 16.0 (SPSS Inc., Chicago, IL, USA). The Shapiro–Wilk test was used to analyze the distribution of data, and the Bartlett test was used to determine the homogeneity of variances. For parametric testing, we adopted a one-way ANOVA analysis to assess the statistical significance of variables followed by the Tukey test. The significant differences of data were set at P < 0.05.

Antisense yycF regulated the biofilm associated genes and protein in MRSA

Quantitative RT-PCR analyses demonstrated that the expression levels of the yycG and yycF genes in were significantly reduced, which may be attributable to the overexpression of ASyycF in the S. aureus treated with H₂O₂. Furthermore, the expression levels of icaA related to the oxide stress reaction and biofilm-associated ica genes were more significantly reduced by ASyycF overexpression in the ASyycG strains treated with H₂O₂ than in the MRSA parent strains (P < 0.05; Fig. 1A). Consistently, the YycF protein expression was significantly downregulated in the ASyycF group treated with H₂O₂ compared with the MRSA parent strains (Fig. 1B). These results indicated that antisense yycF inhibited the production of the YycF, which may have contributed to reductions in downstream icaA gene expression.

Antisense yycF sensitized MRSA to H₂O₂ intervention and vancomycin antibiotic

The SEM results similarly showed the biofilm construction in ASyycF + H₂O₂ group most sparse than other groups (Fig. 2A). Vancomycin is the primary option for MRSA infections. By E-test, the sensitivity of MRSA to vancomycin decreased from 5 to 3 mg/L after ASyycG overexpression and 5 to 1 mg/L after ASyycF overexpression (Fig. 2B). These results also showed that antisense yycF was much more effectively than antisense yycG on enhance the susceptibility of MRSA to H₂O₂.

The antibacterial effect of H₂O₂ was significantly enhanced by ASyycF and ASyycG compared with MRSA group even after 24hrs intervention with H₂O₂ and culture in TSB (Fig. 3A). Quantitively, we evaluated the ability of the MRSA strains to form biofilms after 24hrs intervention with H₂O₂ and culture in TSB. Immunofluorescence density for the dead/live ratios exhibited ASyycF + H₂O₂ group was at 0.3 around (Fig. 3B). The biomass was quantified via a microtiter dish assay, and ASyycF + H₂O₂ group exhibited more reduced biofilm formation compared with MRSA group from 1.4 to 0.8. Similarly, AsyycG + H₂O₂ group reduced biofilm formation compared with MRSA group, but less effective than ASyycF + H₂O₂ group (Fig. 3C).

Staphylococcus aureus is a major human pathogen, which is responsible for a wide range of infective diseases. With the development of antibiotic resistant strains such as MRSA, S. aureus-based infections are becoming more difficult to being treated [13]. The propensity of bacteria to produce biofilms was one of most essential factors, which contributed to the pathogenesis and resistance [14]. In this study, antisense yycF strategy was applied to MRSA strains to significantly down-regulate biofilm production associated YycFG pathway, which could as a promising strategy to overcome this biofilm developed infections.

Two-component systems (TCSs) were ubiquitously found in bacteria [15]. The highly conserved YycFG (also known as WalRK) TCSs reveal a major role in controlling biofilm formation in low-G + C gram-positive bacteria including S. aureus [7]. Antisense is a kind of complementary sequences hybridized to their target mRNA and inhibits the transcriptions of the corresponding genes [16]. In our study, the expression of YycFG TCS and biofilm production associated ica genes were accordingly down-regulated by antisense yycF or yycG. In S. epidermidis, a classical staphylococci bacterium, biofilm formation could also be inhibited via the blockade of extracellular domain of the YycG protein [17–18]. From this point, YycFG TCS may be a potential candidate for the eradication of staphylococci infections. YycG proteins act as a sensor sensing environmental signals and YycF could directly regulate different sets of vital functional genes by binding to the promoter regions [19]. Our results also showed antisense yycF not only depresses the sensitive of MRSA strains to environmental clues but also disrupted cytoplasmic adaptive activities by downregulation both YycF and YycG expressions.

In S. aureus, the only polysaccharide intercellular adhesin (PIA) is associated with ica locus [20]. PIA strongly contributes to biofilm formation leading resistance to antimicrobial agent. According to our previous study, ica expression was controlled by YycFG [7]. In our study, the antisense could cause a significant biofilm reduction by inhibiting YycFG as well as ica expression. Two-component signal transduction systems were essential in response to environmental stimuli, involving adaptation to oxidative stress [21]. Therefore, there will be an adaptive regulation when occurred with H₂O₂ treatment. In present study, YycFG expression can be significantly decreased by ASyycF, even under oxidative stress intervention with H₂O₂. From this point, ASyycF has a potential as a kind of enhancer to improve the antibacterial efficiency of H₂O₂ by suppression resistance and adaption to oxidative stress. S. aureus is the leading cause of osteomyelitis with biofilm formation on the destructed bone matrix or necrotic bone, 1,000 times more tolerant to antibiotic and greatly contributions to cause of treatment recalcitrance were identified [22]. Without the shelter of biofilm, the susceptibility of pathogen was reversible [23]. The vancomycin was a gold treatment for clinical MRSA infections [24]. With the interruption of antisense, MRSA biofilms were significantly reduced without the shelter of biofilm, which enhanced the sensitivity of vancomycin. In addition, the resistance of hydrogen peroxide, which was a common biocide used for cleaning and debriding infections was destructed synergically by the antisense strategies [25].

Antisense oligonucleotides provide a therapeutic potential for treating infection disease [26]. However, nucleases are capable to degrading the antisense oligonucleotides rapidly, which limit their efficacy [27]. Hydrogel scaffolds such as alginate-based hydrogel has been designed for infection inducing bone defects [28]. They could be employed as gene carrier’s protection from the inflammation-mediated degradation and control release [29]. Our previous study showed nano sized platform such as graphene oxide as a kind of nano knife could significantly improving the transformation effectiveness of antisense oligonucleotides [30]. Therefore, further investigations on composition nano material functioned hydrogel will widen the possibility of antisense strategy for clinical infection control.

In the current study, overexpression of ASyycF/G significantly downregulate biofilm formation and the transcripts of the pathogenicity associated genes. Also, the sensibility to vancomycin was improved in ASyycF/G overexpression MRSA. Furthermore, the antisense RNAs, as post‑transcriptional regulators, reveal a potential supplementary strategy for managing MRSA infections.

S. aureus

Staphylococcus aureus;

ASyycG

antisense yycG RNA;

PIA

Polysaccharide intercellular adhesion;

S. epidermidis

Staphylococcus epidermidis;

TCSs

two-component signal transduction systems;

response regulator;

ASRNA

Antisense RNA;

EMSA

electrophoretic mobility shift assay;

EPS

Extracellular polysaccharide substance;

PIA

Polysaccharide intercellular adhesion;

TSB

Tryptic soy broth; CSP:Competence stimulating peptide;

KEGG

Kyoto Encyclopedia of Genes and Genomes;

Crystal violet;

CFU

Colony-forming units;

SEM

Scanning electron microscopy;

qRT-PCR

Quantitative real-time polymerase chain reaction;

Cycle values;

PVDF

Polyvinylidene fluoride;

APS

Ammonium persulfate;

TEMED

tetramethylethylenediamine;

sarA

Staphylococcal accessory regulator;

yycG

membrane-bound sensor histidine kinase associated with cell wall metabolism

Ethics approval and consent to participate:Not applicable.

Consent for publication: All authors understand that the text and any pictures or videos published in the article, and give our consent for information to be published in JOSR.

Availability of data and materials: All data generated or analyzed during this study are included in this published article. The datasets used or analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests: The authors declare no conflict of interest.

Funding: This work was supported in part by the Sichuan Provincial Natural Science Foundation of China (Grant No. 2019YFS0270; 2021YJ0455).

Authors' contributions: Conceptualization, Yu Chen; Data curation, Yu Chen and Rong Fang; Funding acquisition, Hui Zhang and Shizhou Wu; Investigation, Shizhou Wu and Lei Lei; Methodology, Yu Chen and Rong Fang; Supervision, Hui Zhang and Yunjie Liu; Writing – original draft, Yu Chen, Rong Fang, Yunjie Liu, L and Hui Zhang; Writing – review & editing, Shizhou Wu, Yunjie Liu, Lei Lei and Hui Zhang.

Acknowledgments: Not Applicable.

Institutional Review Board Statement: Not Applicable.

Informed Consent Statement: Not Applicable.

Data Availability Statement: Not Applicable.

Wertheim, H.F.; Vos, M.C.; Ott, A.; van Belkum, A.; Voss, A.; Kluytmans, J.A.; van Keulen, P.H.; Vandenbroucke-Grauls, C.M.; Meester, M.H.; Verbrugh, H.A. Risk and outcome of nosocomial Staphylococcus aureus bacteraemia in nasal carriers versus non-carriers. Lancet. 2004,364,703-705.
Klevens, R.M.; Morrison, M.A.; Nadle, J.; Petit, S.; Gershman, K.; Ray, S.; Harrison, L.H.; Lynfield, R.; Dumyati, G.; Townes, J.M.; Craig, A.S.; Zell, E.R.; Fosheim, G.E.; McDougal, L.K.; Carey, R.B.; Fridkin, S.K. Active Bacterial Core surveillance (ABCs) MRSA Investigators. Invasive methicillin-resistant Staphylococcus aureus infections in the United States. JAMA. 2007,298,1763-1771.
Rapun-Araiz, B.; Haag, A.F.; De Cesare, V.; Gil, C.; Dorado-Morales, P.; Penades, J.R.; Lasa, I. Systematic Reconstruction of the Complete Two-Component Sensorial Network in Staphylococcus aureus. mSystems. 2020,5,e00511-20.
Wu, S.; Lin, K.; Liu, Y.; Zhang, H.; Lei, L. Two-component signaling pathways modulate drug resistance of Staphylococcus aureus (Review). Biomed. Rep. 2020,13,5.
Villanueva, M.; García, B.; Valle, J.; Rapún, B.; Ruiz de Los Mozos, I.; Solano, C.; Martí, M.; Penadés, J.R.; Toledo-Arana, A.; Lasa, I. Sensory deprivation in Staphylococcus aureus. Nat. Commun. 2018,9,523.
Wang, S.; Long, L.; Yang, X.; Qiu, Y.; Tao, T.; Peng, X.; Li, Y.; Han, A.; Senadheera, D.B.; Downey, J.S.; Goodman, S.D.; Zhou, X.; Cvitkovitch, D.G. Dissecting the Role of VicK Phosphatase in Aggregation and Biofilm Formation of Streptococcus mutans. J. Dent. Res. 2021,22034520979798.
Wu, S.; Huang, F.; Zhang, H.; Lei, L. Staphylococcus aureus biofilm organization modulated by YycFG two-component regulatory pathway. J. Orthop. Surg. Res. 2019,14,10.
Watts, J.K.; Corey, D.R. Silencing disease genes in the laboratory and the clinic. J. Pathol. 2012,226,365-379.
Streicher, L.M. Exploring the future of infectious disease treatment in a post-antibiotic era: A comparative review of alternative therapeutics. J. Glob. Antimicrob. Resist. 2021,24,285-295.
Sully, E.K.; Geller, B.L. Antisense antimicrobial therapeutics. Curr. Opin. Microbiol. 2016, 33,47-55.
Dubrac, S.; Bisicchia, P.; Devine, K.M.; Msadek, T. A matter of life and death: cell wall homeostasis and the WalKR (YycGF) essential signal transduction pathway. Mol. Microbiol. 2008,70,1307-1322.
Wu, S.; Liu, Y.; Lei, L.; Zhang, H. Antisense yycG Regulation of Antibiotic Sensitivity of Methicillin-Resistant Staphylococcus aureus in Chronic Osteomyelitis. Surg. Infect. 2019,20,472-479.
Monaco, M.; Pimentel de Araujo, F.; Cruciani, M.; Coccia, E.M.; Pantosti, A. Worldwide Epidemiology and Antibiotic Resistance of Staphylococcus aureus. Curr. Top. Microbiol Immunol. 2017,409,21-56.
Juncker, R.B.; Lazazzera, B.A.; Billi, F. The use of functionalized nanoparticles to treat Staphylococcus aureus-based surgical-site infections: a systematic review. J. Appl. Microbiol. 2021. doi: 10.1111/jam.15075.
Liu, H.; Zhao, D.; Chang, J.; Yan, L.; Zhao, F.; Wu, Y.; Xu, T.; Gong, T.; Chen, L.; He, N.; Wu, Y.; Han, S.; Qu, D. Efficacy of novel antibacterial compounds targeting histidine kinase YycG protein. Appl. Microbiol. Biotechnol. 2014,98,6003-6013.
Moustafa, D.A.; Wu, A.W.; Zamora, D.; Daly, S.M.; Sturge, C.R.; Pybus, C.; Geller, B.L.; Goldberg, J.B.; Greenberg, D.E. Peptide-Conjugated Phosphorodiamidate Morpholino Oligomers Retain Activity against Multidrug-Resistant Pseudomonas aeruginosa In Vitro and In Vivo. mBio. 2021,12,e02411-20.
Lyu, Z.; Shang, Y.; Wang, X.; Wu, Y.; Zheng, J.; Liu, H.; Gong, T.; Ye, L.; Qu, D. Monoclonal Antibodies Specific to the Extracellular Domain of Histidine Kinase YycG of Staphylococcus epidermidis Inhibit Biofilm Formation. Front. Microbiol. 2020,11:1839.
Kranjec, C.; Morales Angeles, D.; Torrissen Mårli, M.; Fernández, L.; García, P.; Kjos, M.; Diep, D.B.; Staphylococcal Biofilms: Challenges and Novel Therapeutic Perspectives. Antibiotics. 2021,10,131.
Winkler, M.E.; Hoch, J.A. Essentiality, bypass, and targeting of the YycFG (VicRK) two-component regulatory system in gram-positive bacteria. J. Bacteriol. 2008,190,2645-2648.
Nguyen, H.T.T.; Nguyen, T.H.; Otto, M. The staphylococcal exopolysaccharide PIA - Biosynthesis and role in biofilm formation, colonization, and infection. Comput. Struct. Biotechnol J. 2020,18,3324-3334.
Shor, E.; Chauhan, N. A case for two-component signaling systems as antifungal drug targets. PLoS Pathog. 2015,11,e1004632.
Gimza, B.D.; Cassat, J.E. Mechanisms of Antibiotic Failure During Staphylococcus aureus Osteomyelitis. Front. Immunol. 2021,12,638085.
Shenkutie, A.M.; Yao, M.Z.; Siu, G.K.; Wong, B.K.C.; Leung, P.H. Biofilm-Induced Antibiotic Resistance in Clinical Acinetobacter baumannii Isolates. Antibiotics. 2020,9,817.
Rodvold, K.A.; McConeghy, K.W. Methicillin-resistant Staphylococcus aureus therapy: past, present, and future. Clin. Infect. Dis. 2014,58,S20-7.
Raval, Y.S.; Flurin, L.; Mohamed, A.; Greenwood-Quaintance, K.E.; Beyenal, H.; Patel, R. in vitro Activity of Hydrogen Peroxide and Hypochlorous Acid Generated by Electrochemical Scaffolds Against Planktonic and Biofilm Bacteria. Antimicrob. Agents. Chemother. 2021,AAC,01966-20.
Brown, D.G.; Wobst, H.J. A Decade of FDA-Approved Drugs (2010-2019): Trends and Future Directions. J. Med. Chem. 2021,64,2312-2338.
Sardone, V.; Zhou, H.; Muntoni, F.; Ferlini, A.; Falzarano, M.S. Antisense Oligonucleotide-Based Therapy for Neuromuscular Disease. Molecules. 2017,22,563.
Zhou, W.; Li, Q.; Ma, R.; Huang, W.; Zhang, X.; Liu, Y.; Xu, Z.; Zhang, L.; Li, M.; Zhu, C. Modified Alginate-Based Hydrogel as a Carrier of the CB2 Agonist JWH133 for Bone Engineering. ACS Omega. 2021,6,6861-6870.
Madry, H.; Venkatesan, J.K.; Carballo-Pedrares, N.; Rey-Rico, A.; Cucchiarini, M. Scaffold-Mediated Gene Delivery for Osteochondral Repair. Pharmaceutics. 2020,12,930.
Wu, S.; Liu, Y.; Zhang, H.; Lei, L. Nano-graphene oxide improved the antibacterial property of antisense yycG RNA on Staphylococcus aureus. J. Orthop. Surg. Res. 2019,14,305.

Download PDF

Version 1

posted

You are reading this latest preprint version

Antisense RNA Enhanced Sensitivity of Methicillin-resistant Staphylococcus Aureus to Hydrogen Peroxide

Status:

Version 1

Abstract

Figures

Introduction

Methods And Materials

Bacterial strains and biofilms growth conditions

Construction of S. aureus antisense yycF/yycG overexpression strains

Analysis of gene expression using quantitative real-time PCR (qRT-PCR)

Western Blotting

Biofilms exposure to hydrogen peroxide

The microtiter dish assay and epifluorescence staining for biofilm biomass

Characterizing biofilm morphologies

Data analysis

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Status:

Version 1