Chemicals
Ferrostatin-1 and DHA both from Aladdin (Shanghai, China) were dissolved in dimethyl sulfoxide (DMSO) into a stock concentration of 5 mM and 50 mM, respectively. Deferoxamine mesylate salt (DFOM; MedChemExpres, Monmouth Junction, NJ, USA) and iron chloride hexahydrate (Aladdin) were dissolved in distilled H2O into stock concentrations of 50 mM and 2 mg/L, respectively.
Cell culture and transfection
PLC cell lines, including Hep3B (p53 null), Huh7 (659 A>G TP53 mutant), PLC/PRF/5 (TP53 747 G>T mutant) and HepG2 (p53 wild-type), were provided by Cell Bank of Chinese Academy of Sciences (CBCAS, Shanghai, China). The short tandem repeat (STR) of each cell line was confirmed correct. No mycoplasma contamination was detected. Hep3B, PLC/PRF/5 and HepG2 cells were maintained in MEM (Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS; HyClone, Logan, UT, USA), while Huh7 cells were cultured in DMEM supplemented with 10% FBS. Cells were maintained in an HF-90 cell incubator (Lishen, Shanghai, China) in an atmosphere of 5% CO2 at 37 ℃. PLC cells were transfected with siATF4 (Forwards 5’-3’, guccuccacuccagaucautt; Reversed 5’-3’, augaucuggaguggaggactt), siXBP1 (Forwards 5’-3’, gcaagugguagauuuagaatt; Reversed 5’-3’, uucuaaaucuaccacuugctt), siATF6 (Forwards 5’-3’, gaaaugucgguucagauautt; Reversed 5’-3’, auaucugaaccgacauuuctt) or siCHAC1 (siRNA-1 Forwards 5’-3’, gacgcuccuugaagaucautt, Reversed 5’-3’, augaucuucaaggagcguctt; siRNA-1 Forwards 5’-3’, gccacaaccuugaauacuutt, Reversed 5’-3’, aaguauucaagguuguggctt) for 24 hrs, and then treated with DHA for additional 24 hrs.
Cell viability assay
PLC cells were treated with different concentrations of DHA, and their viabilities were determined with CCK-8 (Sigma-Aldrich, St. Louis, MO, USA). In short, PLC cells were placed into 96-well plates at a density of 3×103/well, and 24 hrs later, they were treated with 2, 5, 7.5, 10, 20, 30, 40 or 50 μM DHA for 24 hrs. Then, cells were incubated with 10 μL CCK-8 for 1 hr, and the absorbances at 450 nm were determined with a microplate reader (BioTek, Winooski, VT, USA).
PLC cell xenografted tumor mouse models
Male nude mice (BALB/c) of 6-8 weeks old (18-20g) were obtained from HFK Bioscience (Beijing, China), and housed in specific pathogen free facility. A total of 32 mice were subjected into the xenograft mouse model experiment, and randomly divided into four groups (n = 8/group). PLC cells were subcutaneously injected into the nude mice. The tumor volumes were determined by using the following formula: 0.5 × tumor length × (tumor width)2. When the xenografted tumor grew into a size of approximately 80-100 mm3, half mice in each group were given 100 mg/kg DHA for 5 d per week by gavage. Twenty-one days later, all mice were sacrificed by isoflurane anaesthesia and cervical dislocation before collecting the tumor tissues.
Hematoxylin and eosin (H&E) staining
Tumor tissues were collected, fixed in 4% paraformaldehyde, and embedded into paraffin. The tissue blocks were sliced into 5-μm sections. Following the deparaffinating and rehydration, the samples were incubated with H&E staining agents according to the manufacture’s protocols.
ROS measurements
Contents of total ROS and lipid ROS were determined with an ROS assay kit (NJJCBio, Nanjing, China; Invitrogen, Carlsbad, CA, USA) based on DCFH-DA and BODIPY 581/591 C11 fluorescence as per the supplier’s protocols. The DCF and C11-BODIPY fluorescence intensities were analyzed with the Tecan M200 PRO automatic microplate reader or a flow cytometer.
Iron concentration
Intracellular ferrous iron levels were analyzed by using an iron assay kit obtained from Leagene Biotech. (Beijing, China) according to the manufacturer’s instructions. The output was measured on the Tecan M200 PRO reader at optical density (OD) of 562 nm.
Malondialdehyde (MDA), GSH levels, and GSH-PX activity
According to the manufacturer’s instructions, A003-1, A061-1 and A005 kits (all from NJJCBio) were used to determine MDA levels, GSH levels and GSH-PX activity, respectively.
Reverse transcriptional PCR (RT-PCR)
Total RNAs were isolated from PLC cells treated with DHA for 1, 6, 12, or 24 hrs. The splicing of XBP1 mRNA (NM_005080 and NM_001079539) was assessed with RT-PCR. One pair of primers (forward, 5’-3’ aaacttttgctagaaaatcagc; reverse, 5’-3’ caataccgccagaatcca) that spanned the sliced site was used for RT-PCR. Two fragments (252 bp and 226 bp) can be detected. PCR products were analyzed with agarose gel.
Western blotting analysis
Total proteins from the whole cell lysates were isolated by using RIPA lysis buffer containing 1% PMSF (SolarBio, Beijing, China). Nuclear proteins were isolated with a Nuclear and Cytoplasmic Protein Extraction kit (Beyotime, Shanghai, China). Protein concentrations were analyzed with a BCA kit (SolarBio). After separating via SDS-PAGE, proteins were transferred to PVDF membranes (Millipore, Billerica, MA, USA), and blocked with 5% non-fat milk for 1 hr. The membranes were treated with primary antibodies at 4℃ overnight, and then with secondary antibodies at 37℃ for 1 hr. The information of primary antibodies were shown in Table 1. Colors of protein blots were developed by incubating the membranes with ECL agent (SolarBio).
pGL3 luciferase reporter assay
The promoter (-2000bp to +30 bp) of CHAC1 gene was inserted into pGL3 luciferase reporter, and the promoter activity was determined by analyzing Firefly/Renilla luciferase ratio according to the manufactory’s instructions (Promega, Madison, WI, USA)
Statistical analysis
Data were expressed by mean values ± standard deviation. GraphPad Prism version 8.0 software was utilized to compare the data. One-way analysis of variance (ANOVA) and two-way ANOVA followed by Bonferroni’s multiple comparison test were used to compare data from multiple groups. A p-value < 0.05 was considered significant.