2.1. Animals and Experimental Design
This experiment was approved by the Shanxi Agricultural University Animal Experiment Ethics Committee, and the license number was SXAU-EAW-2017-002Chi.001. A total of 108 one-day-old ISA brown hens (IBH) with a 40 g average weight were chosen. Chickens were randomly divided into three groups, each group had 6 cages with 6 chickens per cage. According to the actual production, different levels of eubiotic lignocellulose OptiCell (OC) were added to the basic feed (Jinzhong Shiyang Feed Ltd, Shanxi, China) (Table 1) for 0-8 weeks. Group one was given 1% eubiotic lignocellulose and was called the OC-low (OL) group. Group two was given 2% eubiotic lignocellulose and was called the OC-high (OH) group. The control group was not given it, it was OC-free (OF) group. Samples were harvested to measure the gut microbiota, the concentration of SCFAs and so on of IBH at the end of 8 weeks.
The eubiotic lignocellulose (Beijing e-feed & e-vet cooperation, Beijing, China ) was developed by Agromed Ltd. (Austria), and it is made from special fresh timber. The composition of it ccontains energy ~0%, moisture 8%, crude protein 0.9%, total dietary fiber (TDF) 88%, crude ash 1.0%, crude fat 0.8%, minerals & trace elements 1.3%, crude fiber 59%, soluble TDF 1.3%, NDF 78%, ADF 64% and lignin 25%–30%.
Table 1
Ingredients and nutrition level of feed during 0-8 weeks
Ingredients (%)
|
|
Nutrition level
|
|
Corn
|
61.95
|
ME (MJ/kg)
|
12.43
|
Soybean meal
|
23.7
|
Crude protein (%)
|
19.49
|
Soybean oil
|
1.1
|
Crude fiber (%)
|
3.21
|
Corn gluten meal
|
4
|
Crude fat (%)
|
4.27
|
DDGS
|
4
|
Crude ash (%)
|
5.83
|
Stone power
|
1.8
|
Ca (%)
|
1.05
|
CaHPO4
|
1.3
|
Total P (%)
|
0.57
|
NaCI
|
0.3
|
NaCI (%)
|
0.3
|
Met
|
0.2
|
|
|
Lys
|
0.46
|
|
|
Thr
|
0.09
|
|
|
Multivitamin 1
|
0.4
|
|
|
Minerals 2
|
0.55
|
|
|
Choline chloride
Complex enzyme
|
0.1
0.05
|
|
|
Total
|
100
|
|
|
1 Feed (per kg) contains: vitamin A 2100-2500 KIU, vitamin D3 800-1240 KIU, vitamin E ≥ 5900 IU, vitamin K3 ≥ 600 mg, vitamin B1 ≥ 620 mg, vitamin B2 ≥ 1600 mg, vitamin B6 ≥ 830 mg, niacinamide ≥ 7000 mg, vitamin B12 ≥ 4200 μg, pantothenic acid ≥ 2450 mg, folate ≥ 245 mg, biotin ≥ 35 mg. 2 Feed (per kg) contains: Cu 8 mg, Fe 80 mg, Mn 60 mg, Se 0.15 mg, Zn 40 mg, I 0.35 mg.
2.2. Management
Chickens were fed in brood cages for 0-8 weeks. Chickens were given free access to water and feed. The management of the temperature, light, and humidity was conducted according to the breeding manual of IBH. No conventional immunization schedule of chickens was performed to avoid impacts on gut microbiota. Body weights and feed intake of each group of chickens were recorded.
2.3. Sampling
We collected a part of feed and chose six chickens per group to collect the total feces for the determination of fiber digestibility. The blood was collected from the wing vein after these chickens were fasted for 12 h. The blood tube vessels were bathed in water at 37°C for 1 h, followed by 3000 r centrifugation for for 10-15 min. The upper serum was absorbed into several 0.5 ml centrifuge tubes before being stored at -20°C until further blood glucose, GLP-1 and PYY analysis. They were executed with humanitarian slaughter and the length and weight of the cecum were measured. Several pieces of liver were also collected and preserved at -20°C until the determination of the content of liver glycogen. We sampled two pieces from the middle of the cecum and put them into 4% paraformaldehyde fixative solution for 24 h. The contents of the cecum were collected into multiple cryogenic tubes, and they were put into a liquid nitrogen tank and preserved at -80°C until the determination of the 16S rRNA gene sequence of gut microbiota and SCFAs. As above, the cecum was gathered to determine the relative expression of GPR43 mRNA.
2.4. Determination
2.4.1. 16S rRNA Gene Sequencing
The 16S rRNA gene of gut microbiota was sequenced by Genedenovo Biotechnology Ltd (Guangzhou, China) using High-Throughput Sequencing Technology. First, DNA extraction and PCR amplification were performed using the HiPure Stool DNA Kits (Magen, Guangzhou, China). V3-V4 regions of the 16S rRNA gene were amplified by PCR using primers 341F 5’-CCTACGGGNGGCWGCAG and 806R 3’-GGACTACHVGGGTATCTAAT. Illumina Hiseq 2500 sequencing was successively extracted.
Bioinformatics analysis. (1) Quality control and reads assembly. (2) OTU cluster. Effective tags were clustered into operational taxonomic units (OTUs) of ≥ 97% similarity using the UPARSE pipeline [26]. (3) Taxonomy classification. The representative sequences were classified into organisms by a Naive Bayesian Model using RDP classifier [27] based on SILVA Database [28]. Becteria biomarker features of each group were screened by Metastats [29] and LEfSe (linear discriminant analysis (LDA) effect size) software [30]. Metastats showed significantly different becteria using p < 0.01 or 0.05. The value of LDA of certain microbes >2 represents that the difference is significant. (4) Alpha diversity analysis. Alpha diversity indexes including ACE, Chao1, Shannon and Simpson were calculated in QIIME. ACE and Chao1 reflect the community richness, and Shannon and Simpson indices reflect the community richness and community diversity.
2.4.2. Crude Fiber Digestibility
The contents of crude fiber in the feed and manure were determined by the conventional method. Crude fiber digestibility (%) was calculated.
2.4.3. The Concentration of SCFAs
The concentration of SCFAs (mmol/100g) in the cecum chyme was measured using the internal standard method with High Performance Gas Chromatography (HPGC) (Trace 1300, Thermo Fisher Scientific, America) [31].
2.4.4 Growth Performance
The average daily feed intake per chicken per group was calculated as the average daily consumption divided by the number of chickens. The average daily gain of per chicken per group was calculated as follows: (current weight - previous weight) ÷ interval days ÷ number of chickens.
2.4.5. The Development of the Cecum
The length and weight of the cecum were measured. Moreover, post 4% paraformaldehyde fixation, the cecum samples were processed using the conventional methods for tissue section, including washing, dehydration, transparence, embedding, slicing, deparaffinization and so on. The height of the cecum fold and the villous height on the cecum fold were measured.
2.4.6. Relative Expression of GPR43 mRNA
We determined the relative expression of GPR43 mRNA using quantitative real-time PCR (qPCR). (1) Regarding the design and synthesis of primers. At present, the gene sequences of the SCFAreceptors GPR43 (FFAR2) and GPR41 (FFAR3) of chicken have not been included in the NCBI database. Only the primers of GPR43 mRNA were designed and synthesized in this experiment. We found the uniformity of the coding sequences (CDSs) of GPR43 mRNA in humans, mice, cattle and pigs included in NCBI database was 89.7% using the DNAMAN software through BLAST (Figure 1). The conserved region of the highly homologous DNA sequence was selected (red area). Primers of GPR43 were designed with Primer Premier 3.0 software. Reference gene was β–actin. The primers were synthesized by Beijing Genomics Institute (BGI) (Shenzhen, Guangdong, China) (Table 2).
Table 2
The design and synthesis of primers
|
Primer
|
Sequence
|
GRP43
|
Left primer
|
TAGAACGCTACCTGGGAGTG
|
|
Right primer
|
ACCAGAGCAGCGATCACTC
|
β-actin
|
Left primer
|
GAGAAATTGTGCGTGACATCA
|
|
Right primer
|
CCTGAACCTCTCATTGCCA
|
(2) For the extraction of total RNA, liver and cecum tissues were ground to powder with liquid nitrogen, and then 1 g of powder sample was put into a new 1.5 mL centrifuge tube and supplemented with 1 mL of RNAiso Plus (Thermo Fisher Scientific, America). The total RNA was then extracted. (3) For RNA detection, 2 μL of RNA sample was taken to detect the purity and concentration by a nucleic acid protein analyzer. The range of the good-quality OD260/OD280 (R value) should be 1.8–2.2. (4) For the first strand cDNA synthesis, the first strand of cDNA was synthesized by reverse transcription according to the instructions of Primescript TM RT Reagent Kit with gDNA Eraser (Perfect Real Time) (Takara Bio, Japan). The steps were as follows: first, we removed genomic DNA (Table 3a), with the following reaction procedure: 42℃ for 2 min, 4℃ for ∞. Second, we instigated the reverse transcription reaction (Table 3b), with the following reaction procedure: 37℃ for 15 min, 85℃ for 15 s, 4℃ for ∞. (5) For the qPCR reaction system, GPR43 mRNA was amplified with corresponding primers using the cDNA of the cecum and liver tissues as a template. The qPCR reaction system was as follows (Table 3c). The qPCR reaction conditions were optimized, and the reaction conditions were as follows: pre denaturation at 95℃ for 30 s, denaturation at 95℃ for 5 s, 56℃ for 30 s, 95℃ for 15 s, 56℃ for 1 min, 95℃ for 30 s, 56℃ for 15 s, 40 cycles.
Table 3
Reagent
|
Dosage
|
(a) DNA remove reaction system
|
|
5×gDNA Eraser Buffer
|
2 μL
|
gDNA Eraser
|
1 μL
|
Total RNA
|
1 μg
|
RNase Free dH2O
|
up to10 μL
|
(b) The reverse transcription reaction system
|
|
5×PrimeScript Buffer 2
|
4 μL
|
PrimeScript RT Enzyme Mix 1
|
1 μL
|
RT Prime Mix
|
1 μL
|
RNase Free dH2O
|
4 μL
|
Reaction liquid (Table 2)
|
10 μL
|
(c) The qPCR reaction system
|
|
2×Es Taq Master Mix
|
10 μL
|
Forward Primer, 10 μM
|
1 μL
|
Reverse Primer, 10 μM
|
1 μL
|
cDNA template
|
2 μL
|
RNase Free dH2O
|
6 μL
|
(6) Regarding the calculation method, first, the cycle threshold (CT) of the reference gene was normalized to the CT value of the target gene: ΔCT (treatment groups) = CT (experiment target gene) - CT (experimental reference gene); ΔCT (control group) = CT (control target gene) - CT (control reference gene). The target gene was GPR43, and the reference gene was β-actin. Second, the ΔCT value of the control group was normalized to the ΔCT value of the experimental groups: ΔΔCT = ΔCT (experiment groups) - ΔCT (control group). Finally, the expression level ratio 2 - ΔΔ CT was calculated. The value of the relative expression of GPR43 mRNA in the control group was regarded as 1, and the fold between the experiment groups and the control group was calculated.
2.4.7. Blood Glucose and Liver Glycogen
We determined the concertration of blood glucose (mmol/L) in the serum according to the instructions of Blood Glucose Kit (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China). We determined the content of liver glycogen (mg/g) according to the instructions of Liver Glycogen Kit (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China).
2.4.8. GLP-1 and PYY
We assayed the concertration of GLP-1 and PYY in the serum by using the Chicken GLP-1 ELISA kit and PYY ELISA kit (Shanghai Huyu Biotechnology Co., Ltd. Shanghai, China), respectively. The units of them are both pmol/L.
2.5. Statistical Analysis
In terms of gut microbiota, abundance statistics of each taxonomy were visualized using Krona [32]. The comparison of alpha diversity indexes between groups was calculated by Welch's t-test and Wilcoxon rank test using Vegan package in R project, and the comparison among groups was computed by Tukey’s HSD test and the Kruskal-Wallis H test using Vegan package in R project [33]. Statistical analyses of other indexes were performed using a one-way analysis of variance (ANOVA) with Statistical Product and Service Solutions (SPSS) 22.0 (IBM). The results were expressed as the means and standard error of the mean (SEM).