Samlpes and cells
This study was approved by the Ethics Committee of Animal Experiments from the Animal Science and Technology College at Shihezi University. All samples were collected in strict accordance with the committee’s guidelines. Ninety-day sheep fetus tracheas were obtained from a live animal slaughtering center in Shihezi, Xinjiang province. The specimens were collected by trained personnel and specialized veterinarians following the animal welfare protocols of the First Affiliated Hospital of the Medical College of Shihezi University and College of animal science and technology. During the experiment, every effort was made to minimize animal suffering.
miRNA-mRNA joint analysis and prediction of target genes
This analysis was based on a high-throughput sequencing database and transcriptome sequencing database established earlier in this project (Unpublished). First, according to the fold-change, P-value, and Q-Value of the high-throughput sequencing database, it was determined that mir-509-5p was differentially expressed. miRNA-mRNA joint analysis also determined that mir-509-5p was a differentially expressed miRNA. TargetScan and RNAhybrid (USA) were used to predict the target genes of the differentially expressed oar-miR-509-5p (Ovis aries miR-509-5p), and the intersection of the results of the two analyses was used as the candidate target genes. Then, combined with sequencing data, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, and reference literature for target gene screening, the candidate target genes were identified for subsequent experimental studies.
Identification and construction of target sequence wild-type and mutant psiCHECKTM-2 vector
Construction of target sequence wild-type psiCHECKTM-2 vector
The 3'-untranslated region (UTR) of one of the candidate target genes, TRAF6 (encoding TNF receptor associated factor 6) was predicted and used to design primers to amplify the wild-type sequence. The primers were designed using Primer 6.0, and added sites for the Not I and Xho I restriction endonucleases to the ends of the amplicon. The 5 end bases were protected and the primers were synthesized by Xinjiang Kuntai Rui Company (Table 2). The wild-type 3'-UTR sequence was then cloned into vector psiCHECK-2 (Promega, USA).
Table 2 Primers information of target gene
Gene
|
Sequence(5’-3’)
|
Size (bp)
|
Tm(°C)
|
TRAF6
|
F:ccgCTCGAGGACTTGCCTTTCACTTTTCA
R: tttGCGGCCGCCCTTCAGGTTTCTTTCAC
|
490
|
56
|
Construction of mutant psiCHECKTM-2 vector
Next, the miRNA binding site in the TRAF6 3'-UTR sequence was mutated. The following sequence was designed and cloned into the psiCHECK-2 vector, which was completed by Shanghai Biotech (China):
CTCGAGCTTTCACTTTTCACTTTCATGCATTGGAGAAGGAAATGGCAACCCACTCCAGTGTTCTTGGCTGGAGAATCCCAGGGACGGGGGAGCCTGGTGGGCTGCCATCTAATTGGTTGCACAGAGTCGGACACGACTGAGGCGACTTGGCAGGAGCAGCAGCAGCAAGGTCTGGAACAAGGAGATTCACATGGTTCTGAGTTCTAACTCTGGAGAAATGCTACATTGTAGCCTAAAGGAAATAGTAAGCAAGGTAGAATGAAACAATTTAAAGGAGAATTAATCACCAACATAGAAAGTTTAAATGTCTCGCCTAGTCAGCCAGTGTGGCAGCTCATTGGTGGTGAGAAAAGTGGTTTGAGCCCAGCGGCCGC
The sequence in bold is the mutated miRNA binding site in the TRAF6 3'-UTR sequence.
Double Digestion of psiCHECKTM-2 Vector
The psiCHECK-2 vector contains two reporter genes, the firefly luciferase gene (hluc+) and the Renilla luciferase gene (hluc). In practical use, the Renilla luciferase value is used as an internal reference, and the firefly luciferase activity is used as the reporter.
For Not I and Xho I digestion, the reaction comprised psiCHECK-2 Vector ( 0.2 μg; 10 × QuickCut Green Buffer (3 μL); QuickCut Xho I (1 μL); QuickCut Not I (1 μL); and ddH2O up to 10–30 μL. The reaction incubated at 37 °C for 1 h. The target band was separated by 1.5% agarose gel electrophoresis, and the product was purified and recovered. The two recovered fragments (wild-type and mutated) were ligated separately into psiCHECK-2 using the following ligation system: Digested psiCHECK-2 (3 µL), target DNA fragment (2 µL), 10 × T4 DNA Ligase Buffer (1 µL), T4 DNA Ligase (1 µL), and dd H2O (3 µL); ligated overnight at 4 °C.
293T cell resuscitation, passage, and transfection
The human embryonic kidney cell line 293T was donated by the College of Animal Science and Technology of Shihezi University. The frozen cells were thawed in a 37 °C water bath. Then, after sterilizing with 75% ethanol, the supernatant liquid was discarded, and the appropriate complete medium (Dulbecco’s modified Eagle’s medium (DMEM): Serum: double antibody=90%:10%:1%) was added to the cells in the cryovial tube. The cells were cultured at 37 °C in 5% CO2. When the cells reached 70–80% density, the cell culture fluid is discarded and the cells were digested with a 0.25% pancreatin solution (Takara, Dalian, China) for 30–60 s. The state of the cells was observed under a microscope. When most of the cells had shed and dispersed, complete culture solution was added to stop digestion. The cells were transferred to a 15 mL centrifuge tube and centrifugedg. The supernatant was discarded and the cells were resuspended in complete medium. Finally, the cells were added to a 6-well culture dish.
To obtain an effective transfection efficiency, the optimal ratio of transfection was determined as 1:2 via pre-experimental plasmid transfection. As observed under an inverted fluorescence microscope, transfection was performed when the cell density reached 70–80%. Then, according to the miRNA product manual (Ruibo Biotechnology Co., Ltd., China), miRNA mimics and inhibitors were formulated as a 20 µM stock solution for transfection experiments. The constructs were transfected into five groups of cells: 1. Control group; 2. Wild-type psiCHECK-2 recombinant plasmid + miRNA mimic; 3. Wild‑type psiCHECK-2 recombinant plasmid + miRNA Negative Control (NC); 4. mutant psiCHECK-2 recombinant plasmid + miRNA mimic; 5. mutant psiCHECK-2 recombinant plasmid + NC miRNA. Three parallel wells were set for each group and transfection was performed according to the instructions of the Lipo2000 reagent.
Luciferase activity assay
The Dual-Luciferase® Reporter Assay System kit (Tiangen, China) was used to assess luciferase activity. At 24 h after transfection, the culture solution was discarded and the cells were rinsed two to three times with pre-warmed 1 × phosphate-buffered saline (PBS). Then, cell lysis solution (Takara) was added to fully lyse the cells. The lysed cells were transferred to a clean Eppendorf tube, centrifuged, and 20 µL of the cell lysate supernatant was added to a Lockwell maxisorp detection plate, followed by 100 µL of Luciferase Reaction Reagent. After shaking and mixing, the plate was placed immediately into the chemiluminescence instrument (Zeiss, Oberkochen, Germany) to detect the firefly luciferase activity value. After detecting the firefly luciferase activity value, 100 µL of Luciferase Reaction Reagent II was added, and after shaking and mixing, the plate was placed into the chemiluminescence instrument to measure the activity of Renilla luciferase.
Primary culture and purification of sheep respiratory epithelial cells
Ninety-day-old fetuses were obtained from beef and sheep abattoirs in Shihezi City (Xinjiang Uygur Autonomous Region, China) and their tracheas were collected rapidly. The tracheas were rinsed with PBS buffer two to three times, cut into small pieces and spread on the bottom of a Petri dish. Subsequently, culture medium (DMEM: Serum: double antibody=90%:10%:1%) was added and the plates were placed at 37 °C in 5% CO2 for culture; the medium was changed every 48 h. After 3–4 days of culture, the mucosal epithelial cells of sheep respiratory tract were purified. First, the tissue block was removed from the culture medium and rinsed with PBS two to three times. The PBS was discarded and 2 mL of trypsin (0.25%) without EDTA was added to each petri dish, and the tissue was digested at 37 °C, 5% CO2 for 2 min. Culture solution was added to stop the reaction. At this point, most of the fibroblasts had adhered to the wall, while the respiratory mucosal epithelial cells did not adhere. By repeating this method multiple times, purified airway mucosal epithelial cells could be obtained.
Cellular immunohistochemistry
The cell slides were fixed in 4% paraformaldehyde solution, dried, incubated with 3% H2O2 at room temperature for 10 min, and washed three times with PBS. The slides were then incubated with 0.3% Triton X-100 for 20 min, and then with PBS-diluted goat serum blocking solution for 40 min. Primary antibodies recognizing keratin 11 (Anti-pan Cytokeratin antibody [C-11], Abcam, Cambridge, MA, USA) were added, and the slides were incubated at 37 °C for 2 h, and washed three times with PBS. Then, an equal amount of horseradish peroxidase-labeled secondary antibody was added, incubated at 37 °C for 60 min, and washed three times with PBS. Finally, the cells on the slides were stained using a 3,3'-Diaminobenzidine (DAB) staining kit. The cells were then counterstained with hematoxylin for 30 s to 1 min at room temperature for 1 min, and washed with PBS for 10 s. The slides were sealed with gum and examined under a microscope.
Measuring target genes and pathway genes mRNA expression
Total RNA was extracted from cells and isolated using the TRIzol reagent (Invitrogen). One microgram of total RNA was used to perform reverse transcription using a PrimeScript RT Reagent Kit with gDNA Eraser (Takara) according to the manufacturer’s instructions. The primers for all target genes are shown in Table 3. Quantitative real-time polymerase chain reaction (qPCR) was performed using a LightCycler 96 Real-Time qPCR System (Roche, CH). The 20 μL amplification reaction mixture included 1.0 μL of cDNA, 10 μL of 2 × SYBR Premix Ex Taq, 1 μL of primers (0.5 μL of each forward and reverse primer), and 8 μL of water. The reactions were performed at 94 °C for 5 minutes; followed by 40 cycles at 94 °C for 20 seconds and at 60 °C for 34 seconds. All reactions were performed in triplicate, and the relative quantification of mRNA was performed using the 2-△△Ct method [16].The Ct values were used to calculate ΔCt values for genes of interest [Ct (test)−Ct(reference)]. All experiments were performed at least in triplicate.
Table 3 Real -time quantitative PCR primers
Gene
|
GeneID
|
Size/bp
|
Sequence(5’-3’)
|
Tm/℃
|
TLR4
|
FJ977629.1
|
80
|
F:TGTGAAGGACATGCCAGTGCTTG
R:TGACAACCGACACGCTGATGATC
|
60
|
TIRAP
|
NM_001009806
|
101
|
F:CCTCAGCAGAGCCGCCTACC
R: GCATGACAGCGTCCTTGACTTGG
|
62
|
IRAK4
|
M96845
|
84
|
F:CTCAAGTGATGGCGATGACCTCTG
R: CCATCCAAGCAAGCCAGTCTGTC
|
59
|
TRAF6
|
X52640
|
82
|
F: ACTGAGGCATCTTGAGGAGCATC
R: TTCTGGAAGAGACGCTGGCATTG
|
63
|
TAB2
|
X56756
|
114
|
F: GGAAGCAGGACTCTAACGCACAG
R:GCCTTGAGGAACTTGAGCTGGTG
|
58
|
TAK1
|
FJ958365.1
|
125
|
F: TCCGCCGCTTCTTCCTCCTC
R: GCTCCTCTTCCAACAACCTCTTCC
|
59
|
NF-κB
|
AF038130.1
|
104
|
F:ACAAGCCTGTCACAGCCAACATG
R: TGATGGTGAAGGCTCAGGAGGTG
|
62
|
β-actin
|
U39357
|
108
|
F:AGAGCAAGAGAGGCATCC
R:TCGTTGTAGAAGGTGTGGT
|
60
|
F: forward primer; R: reverse primer; Primers were designed according to the sequence of the target genes obtained from GenBank.
Detecting cell mortality using propidium iodide (PI) staining method
Tracheas were collected from on “BB type” sheep (susceptible sheep) identified by our research group (unpublished), and the respiratory mucosal epithelial cells were isolated as detailed in section 2.5 and cultured. When the cell density reached 90%, an infection experiment was conducted. The experiment was divided into three groups: control group, MO group, and MO + MBL group. Among them, recombinant MBL protein was provided by our laboratory; and Mycoplasma ovipneumoniae (MO) was provided by the Animal Medicine Experimental Center, College of Animal Science and Technology, Shihezi University. The measured bacterial count was colony forming units (CFU) = 106. The instructions of the PI staining test kit were followed to complete the staining process. In the dark, 20 μL of the cell‑dye mixture was dropped onto the loading chip, and the chip was inserted into the Adam-mc counter for detection and calculation of cell mortality.
Measurement of IL-12, TNF-α, IL-6, IL-1β release
MO infection was performed after 24 hours of cell culture. The cell culture medium was collected from the blank control group, the experiment control group (blank control group + MO), the miR-509-5p mimic group (miR-509-5p mimic + MO), and the miR-509-5p mimic NC group (miR-509-5p mimic NC + MO) respectively. According to the manufacturer's instructions, interleukin (IL)-12, tumor necrosis factor alpha (TNF-α), IL-6, and IL-1β cytokine secretion levels were measured using an enzyme-linked immunosorbent assay (ELISA) kit (BIM).
Statistical analysis
Each experiment was performed 3 times. The data were expressed as the mean ± the standard error and all statistical analysis were performed with SPSS software version 19.0 (IBM Corp., Armonk, NY, USA). Differences between means were accepted as statistically significant at P < 0.05 and as a trend at 0.05 < P < 0.10.