Patient Samples
In compliance with the Institutional Research Ethics Board at the University Health Network (UHN), all patients provided written consent for the use of their tissues in this study. Diagnostic formalin-fixed paraffin-embedded (FFPE) blocks were obtained from NPC patients (n=246) treated at the Princess Margaret Cancer Center (PMCC) between 1993 to 2009, as previously described [11]. FFPE tissues from patients who underwent quadroscopy and were not diagnosed with NPC (n=17) were used as normal nasopharyngeal epithelial tissues.
NanoString Analysis
RNA was isolated using the Recover All Total Nucleic Acid Isolation Kit for FFPE (Ambion, Austin, TX, USA). Total RNA (200 ng) was assayed using the nCounter Human miRNA Assay v1.0 (Nanostring; 734 unique human and viral miRNAs). Full analyses and protocols can be found in Bruce et al. [11].
Cell Culture
The EBV-positive NPC cell line C666-1, the non-tumorigenic human nasopharyngeal cell lines NP69 (SV40-immortalized) and NP460 (hTert-immortalized), and HEK 293T cells were cultured as previously described [12]. NP69 and NP460 cell lines were generated by SW Tsao’s group [55, 56] and served as “normal” cells throughout this study. Every new batch of cells underwent mycoplasma testing and STR analyses [12]. C666-1, NP69 and NP460 cells were used for gain- and loss-of-function assays; HEK 293T cells were used for lentiviral generation and luciferase assays.
Compound Treatments
SB431542 (#S1067, SelleckChem, Houston, TX, USA), a TGFβ receptor I (TGFβR1, also known as ALK5) inhibitor, was used as indicated. Human TGFβ1 (#8915; Cell Signaling, Danvers, MA, USA) was used where indicated after overnight starvation of cells in Minimum Essential Media (MEM) supplemented with 0.5% FBS.
Transfection
Polyplus-transfection JetPRIME (Graffenstaden, France) was used for transfection of C666-1, NP69, NP460, and HEK 293T cells, according to manufacturer’s specifications. C666-1, NP69, and NP460 cells were transfected with pre-miR-34c or pre-miR negative control (20 nM and 50 nM; Ambion, Austin, TX, USA).
Lentiviral Transduction
Lentiviral transduction was used to generate stable cell lines as previously described [12]. pLV-miRNA-34c (Biosettia, San Diego, CA, USA), pLV-miR-34c-lockers (Biosettia, San Diego, CA, USA), and their respective control vectors were used. All stable cell lines were generated for the purpose of this work.
Quantitative Real-Time PCR (qRT-PCR)
The Total RNA Purification Kit (Norgen Biotek, Thorold, ON, Canada) was used for both mRNA and miRNA isolation. Reverse-transcription of total RNA (1 μg) was performed using the iScript cDNA Synthesis Kit (BioRad, Hercules, CA, USA). qRT-PCR was performed using SYBR Green (Roche, Basel, Switzerland) and the primers are listed in Table 1. mRNA expression was normalized to the average expression of two housekeeping genes (β-actin and GAPDH, as in [12]) and melting curves were generated for each experiment. MiRNA levels were assessed using the TaqMan MicroRNA Assay, and processed according to manufacturer’s instructions (Applied Biosystem, Foster City, CA, USA). RNU44 and RNU48 were used to normalize miR-34c expression [57, 58]. Relative expression was calculated using the 2-ΔΔCt method [59].
Western Blot
Immunoprecipitation buffer (150 mM NaCl, 5 mM EDTA, 50 mM Hepes pH 7.6, 1-2% Nonidet P-40; with protease inhibitor cocktail, Roche), was used for protein extraction. Electrophoresis was performed with Bolt 4-20% Gels (Life Technologies, Carlsbad, CA, USA).
The Epithelial-Mesenchymal Transition Antibody Sampler Kit (Cell Signaling; #9782; 1/1,000 each), anti-TGFβ1 (Cell Signaling; #3711; 1/1,000), and anti-β-actin (Sigma: 1/5,000) antibodies were used. The SuperSignal West Femto ECL (Pierce, #34095, Thermo Scientific, Waltham, MA, USA) was used for ZEB1, CDH1 and ZO-1 detection. Pierce ECL (#32209) was used to detect all other proteins.
RNA Sequencing (RNA-Seq) and Data Analysis
RNA from our cohort of FFPE samples was isolated (200 ng/sample), processed (Ribo-Zero Gold rRNA Removal Kit (Illumina, San Diego, CA, USA)), and sequenced as previously described (as in the NanoString section of [11]). Library preparation was performed using the TruSeq Stranded Total RNA Sample Prep Kit (Illumina, San Diego, CA, USA). Sequencing was conducted on the Illumina HiSeq 2000 to >100 million paired-end 100 bp reads. STAR (v2.4.2a) was used to align the reads [60], and RSEM (v1.2.21) was used to summarize expression values [61].
Luciferase Reporter Assay for MiR-34c/SOX4 Target Activity
MiR-34c was predicted to target the wild-type (WT) 3’-untranslated region (3’UTR) of SOX4 in silico. This region was inserted into the pMIR-REPORT vector (Ambion). JetPRIME was used to reverse transfect HEK 293T cells with pre-miR-control or pre-miR-34c. Twenty-four hours later, JetPRIME was used to co-transfect pRL-SV Renilla vector (Promega, Madison, WI, USA) with either pMIR-SOX4 3’UTR WT (CTAGTGCTCAGCTCAAGTTCACTGCCTGTCAGAT) or pMIR-SOX4 3’UTR Mutant (CTAGTGCTCAGCTCAAGTTTCTGTAAAGTCAGAT). The Dual-Luciferase Reporter Assay (Promega) was used to measure luciferase activity 24 hours post-transfection.
Cell Viability Assays
Stable cell lines generated from C666-1, NP69 and NP460 cells were seeded in 96-well plates (2,000 cells/well). After one day, they were exposed to decreasing concentrations of cisplatin (CDDP) for 72 h as indicated in the figures. Dose-response curves for cisplatin were determined through treatment using two-fold serial dilutions starting from 12.5 ug/mL (which induced ~90% cell death in NP69/NP460 cells after 72 h of treatment). Cell viability was assessed using the ATPlite 1 Step Luminescence Assay System (PerkinElmer, Waltham, MA, USA).
Immunohistochemistry (IHC)
Sections from FFPE blocks were subject to IHC using microwave antigen retrieval. Citric acid (0.01 M, pH 6.0) and the LSAB+ System-HRP (Dako, Les Ulis, France) were used. Rabbit polyclonal anti-SOX4 (PA5-41442, lot#SB2344261A, Invitrogen: 1/40) antibody was used, but omitted for negative control staining. Positive nuclear SOX4 localization was detected by light microscopy. The percentage of positive tumour cells was quantified by evaluating a total of at least 300 tumour cells from the three most densely staining fields (magnification 400×). A final score was calculated as the product of the percentage of positive tumour cells and staining intensity (0=negative; 1=weak; 2=moderate; 3=strong) as previously described [62]. No samples had an intensity score of 3. All scoring was performed blinded to any knowledge of clinical or pathological parameters. Each section was scored at least twice.
Statistical Analyses
All experiments were performed at least three times. In order to maintain independence between replicates, new frozen batches of cells were used each time. Data are presented as the mean ± SEM. GraphPad Prism (GraphPad Software, San Diego, CA, USA) was used for statistical analyses. Intergroup statistical significance was determined using the ANOVA test, with the Bonferroni post-test (if applicable), or the Mann-Whitney U test (socscistatistics.com).