Cell culture
Human non-small cell lung cancer (NSCLC) cells line (A549) and normal line (NuLi-1) were purchased from the American Type Culture Collection (Manassas, VA, USA). The NuLI-1 cells were cultured in Dulbecco’s modified Eagle medium (DMEM; Life Technologies, USA) supplemented with 10% fetal bovine serum (FBS; HyClone, USA), 100 units/ml penicillin (Sigma), 100 µg/ml streptomycin (Sigma) and 2 mM L-glutamine (Sigma). The A549 cells were grown in RPMI-1640 medium (Gibco, USA) and 10% FBS (HyClone, USA) with 100 units/ml penicillin (Sigma), 100 µg/ml streptomycin (Sigma) and 2 mM L-glutamine (Sigma). All the cells were cultured at 37 °C in a humidified atmosphere containing 5% CO2. Cells were digested by trypsinization and passaged in vitro. Cells in the logarithmic growth phase were collected and harvested for all experiments.
Cell transfection
MiR-376a mimics, inhibitor and miR negative control (miR-NC) were obtained from GenePharma Co., Ltd. (Shanghai, China). Small interfering RNA (siRNA) oligonucleotides of Rab1A (sense 5′-GGAAACCAGUGCUAAGAAUT-3′, antisense 5′-AUUCUUAGCACUGGUUUCCTT-3′), which are used to inhibit Rab1A expression in the study was purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). To gain an overexpressing vector of Rab1A, the cDNA of Rab1A was cloned into pFLAG-CMV vector (Sigma) and the resulting construct was named pCMV-Rab1A (Rab1A). When converged to 80%, cells were transfected with 50 nM using Lipofectamine 2000 reagent (Invitrogen, USA) according to the manufacturer’s protocol. After transfection, the transfection efficiency was examined using quantitative reverse transcription polymerase chain reaction (qRT-PCR).
Quantitative RT-PCR analysis
The relative transcript abundance of miR-376a, Rab1A in cells was determined by quantitative real-time PCR (qRT-PCR) using an ABI PRISM® 7500 Sequence Detection System (ABI, USA). As for miRNA detection, cells were lysed and the total miRNA was extracted using RNAiso for Small RNA (Takara, Japan). RT-PCR was performed using Mir-X miRNA First-Stand Synthesis Kit (Takara, Japan) and TB Green Advantage qPCR Premix (Takara, Japan) according to the manufacturer’s recommendation with GADPH as the internal reference. As for mRNA detection, total RNA from each group of cells was extracted using Trizol (Invitrogen, USA) according to the manufacturer’s instructions, and reversed transcribed to cDNA using PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, Japan). QRT-PCR was performed using SYBR Premix Ex TaqTM Kit (Takara, Japan) with GAPDH as the internal reference. All qRT-PCR primers were purchased from Sangon (Shanghai, China) and were as follows: GAPDH forward, 5′-CAGGGCTGCTTTTAACTCTGGT-3′ and reverse, 5′-GATTTTGGAGGGATCTCGCT-3′; miR-376a forward, 5′- GTGCAGGGTCCGAGGT-3′ and reverse, 5′- ATCATAGAGGAAAATCCACG -3′; Rab1A forward, 5′- TTGCCTTCTTCTTAGGTTTGC-3′ and reverse, 5′- GCTTGATTGTTTTCCCGTCT -3′.
Cell viability assay
The viability of the cell was performed by using Cell Counting Kit-8 (CCK-8; Dojindo, Japan) assay. Briefly, transfected cells were cultured for 72 h in RPMI 1640 medium containing 10% FBS (HyClone, USA) and then seeded into 96-well plates at a density of 5×103 cells per well, 10 μL of fresh CCK-8 solution was added to each well and then co-incubated for 4 h at 37 °C. The optical density (OD) of each well was measured the absorbance at 450 nm using a microplate reader (Bio-Rad, USA).
Migration and invasion assays
Cell migration was determined using the scratch assay. After transfection, a 2-mL (1×105 cells/mL) sample of cells was seeded in 6-well plates and incubated for 24 h to allow attachment. The cell layer was scratched, down the middle of the plate well, and the medium was removed; the cells were then washed three times with PBS. Fresh medium containing 3% FBS was added, and the cells were visualized under microscopy after 24 h. To minimize deviation, at least triple views were visualized and captured, and the average number was used.
For invasion assay, dissolved ECM gel (Sigma, 100 mg/well) was added to a 24-Transwell Boyden chamber (Corning, USA) and incubated for 4-8 h at 37 °C. Post-transfection cells in logarithmic phase after trypsinization and suspension were seeded into the Transwell Boyden chamber using 100 μL per well at 5×105 cells/mL, after which 500 μL RPMI1640 medium containing 10% FBS was added to the lower chamber. The cells that did not invade the upper chamber were removed and fixed with methanol. Cells were stained with Giemsa solution and observed by optical microscopy (ECLIPSE Ti2, Nikon, Japan).
Dual-luciferase reporter assay
The luciferase reporter assay was performed according to the methods described previously [10]. In brief, the 3’-UTR of Rab1A with wild-type or mutant binding sites for miR-376a were cloned into pmiR-GLO-Dual-Luciferase miRNA target expression vector plasmid (E1330; Promega, USA) naming pmiR-GLO-Rab1A-WT and pmiR-GLO-Rab1A-Mut, respectively. The A549 cells were co-transfected with pmiR-GLO-Rab1A-WT or pmiR-GLO-Basic-Rab1A-MUT and miR-376a or miR-376a mimic using LipofectamineTM 2000 Transfection Reagent (Invitrogen, USA), according to the manufacturer’s protocol. After incubation for 72 hours, the firefly and Renilla luciferase activities were measured using the Dual-Glo Luciferase System (Promega) according to the manufacturer’s protocol. The firefly luciferase activity was normalized with the Renilla luciferase activity.
Hoechst 33342 staining assay
Cell apoptosis was determined using the Hoechst 33342 staining assay. In brief, 2 mL (1×105 cells/mL) sample of cells was seeded in 12-well plates and incubated for 24 h to allow attachment. After transfection, 10 μL of Hoechst 33342 live cell staining solution (100X) (Beyotime Biotechnology, Shanghai, China) was evenly added to each well. and then co-incubated for 10 minutes at 37 °C. The dye-containing medium was removed and the cells were washed three times with PBS and observed by fluorescence microscope. (ECLIPSE Ti2, Nikon, Japan)
Western blot assay
The total proteins were extracted from treated the cells using RIPA lysis buffer (Beyotime Biotechnology, Shanghai, China) supplemented with protease and phosphatase inhibitor (Biocolor Biosciences & Technology Company, Shanghai, China) according to the manufacturer’s instructions. The protein concentration were detected by a BCA protein assay kit (Beyotime Biotechnology, Shanghai, China), and then equal of total protein was separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (10% SDS-PAGE; Biocolor Biosciences & Technology Company, Shanghai, China) and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA). After The PVDF membranes were blocked with 5% skim milk for 3 h at room temperature and then incubated with primary antibodies overnight at 4 °C. The following primary antibodies were used: Rab1A (1:1000 dilution, Abcam, ab97956). GAPDH (1:1000 dilution, CST, 5174S) was used as an internal reference. The membrane was incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody (1:2000 dilution, Abcam, ab6721) for 2 h at 37 °C. Bands were visualized using NovexTM ECL Chemiluminescence Substrate Reagent kit (Invitrogen, USA) and scanned by InvitrogenTM E-GelTM Imager System. The bands were quantified and analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA).
Statistical analysis
Experiments in this study were repeated independently at least three times, and the results are expressed as the mean ± SD (standard deviation of mean). All data were analyzed using the SPSS statistical package. Univariate sample means were compared using one-way analysis of variance (ANOVA). Least significant difference (LSD) was used to compare multivariate sample means pairwise. P<0.05 (*) or P<0.01 (**) was considered statistically significant.