Cell Lines and Cell culture: HEK293T cell lines were procured from American Type Cell Culture (ATCC, USA) and grown in Dulbecco’s Modified Eagle Media (Gibco) supplemented with 10% (v/v) Fetal Bovine Serum (Gibco, Brazil origin) and 1% antibiotic and antimycotic (Gibco). Cells were incubated at 37°C supplemented with 5% CO2 in a humidified atmosphere and were routinely passaged after confluency reached up to 80%. The cells were routinely tested for mycoplasma infections.
HCMV miRNA mimic, Inhibitors and siRNA: The hcmv-miR-UL70-3p mimic and its inhibitor were procured from Ambion, Life Technologies (Assay ID: MC11312, Cat No: 4464066; MH11312 cat No: 4464084). The sequence of hcmv-miR-UL70-3p: 5´ ggg gau ggg cug gcg cgc gg 3´ . The siRNA of MOAP1 was procured from the Integrated DNA Technologies, Inc., Coralville, IA, USA (cat no: hs.Ri. MOAP1.13.1) and the sequence of siRNA of MOAP1 is 5´ agu aua uag acu guu cua ccu uca ugc 3´.
Transfection and co-transfection: The miR-UL70-3p and its inhibitor were transfected with Dharmafect1 No T-2001-03 (Dharmacon, USA), whereas all the co-transfection experiments were carried out with Lipofectamine 3000 as per the manufacturer’s protocol (L3000008- Invitrogen, USA).
Vectors:
The 3' UTR of MOAP1 was cloned in the pEZX-MT06 vector of Genecopoeia, USA, (cat No: HmiT016794-MT06 & Cat No: Cmi000001-MT06), which contains firefly luciferase as the reporter gene (controlled by the SV40 promoter) and Renilla luciferase as the tracking gene (Controlled by the CMV promoter).
4',6-Diamidino-2-phenylindole (DAPI) staining:
Apoptotic cell nuclei were observed by staining with 4′,6-diamidino-2-phenylindole (DAPI) (Himedia Cat No: TC 229) under the fluorescent Microscope using the blue filter at emission/ excitation 358nm ⁄ 461nm. (Axiovert A1-Carl Zeiss-Jena- Germany) as per the protocol mentioned in Fig 1.
Image analysis:
The apoptotic cell nuclei and their condensation were analysed through ImageJ ver. 1.53 (National Institute of Health, Bethesda, MD). In brief, a nuclear morphology measurement, 16-bit photomicrographs of DAPI stained nuclei were converted to the 8-bit image before being the auto threshold to a binary photo using the default method “Make Binary” function in ImageJ. Touching cell nuclei were separated by the “watershed” function, and small fragments of nuclei were discarded on the basis of the area by the “analyzing particle” function. The latter function also provided other morphological parameters, including nuclear area, circumference, and form factor. By comparing the total numbers of cell nuclei obtained with watershed, an estimated percentage of apoptotic cells were computed by human intervention as the number of apoptotic cell nuclei (irregular shape and degraded shape)/ the total number of DAPI stained nuclei (with watershed) * 100, which provided the average percentage of apoptotic cells in each and every experimental setup.
Caspase-Glo 3/7 assay: The apoptotic induction and inhibition were assessed via Caspase-Glo 3/7 assay kit from Promega (Madison, WI, USA Cat No: G8090) using the luminometer (GloMax® Navigator System, Promega). Briefly, the cells were seeded in 96 well white plates followed by overnight incubation. The HEK293T cells transfected with 30nM of hcmv-miR-UL70-3p & its inhibitor was treated with 0.4 mM H2O2. The culture plate containing the cells were removed from the incubator and equilibrated at room temperature for 30 min. 100μL of Caspase-Glo reagent was added to each well and gently mixed in a plate shaker. The plate was then incubated at room temperature for 2 hrs. Luminescence was read using the Luminometer (GloMax® Navigator System, Promega). Caspase 3 and 7 activity was measured using raw values of luminescence to obtain a relative to control value. The final caspase activity was calculated by averaging three replicates from two independent experiments.
Flow Cytometry:
HEK293T cells were cultured in a 6-well plate followed by transfection, using DharmaFACT1 (Dharmacon), with 30 nM of miR-UL-70-3p and its inhibitor. Apoptosis was induced by treatment with 0.4 mM concentration of H2O2 at 24 hrs post-transfection. After 6 hrs of incubation, cells were washed with PBS, pelleted, and then incubated with 5µL of Annexin-V conjugated with Alexa Fluor 488 (Life Technologies Cat No: A13201) along with the 100 µL of Annexin Binding Buffer for 15 min in the dark. Then, samples were incubated with the 5µL of Propidium Iodide; (Invitrogen; Cat No: P1304MP respectively) in the dark for 10 min. Then samples were analyzed by diluting the cells with 400µL of 1X binding buffer by Flow Cytometry using FACS Canto II and FACSDiva software (Becton Dickinson Biosciences). The data represents the percentage of apoptotic cells in Q2 and Q4 quadrants, in which Q4 shows cell population having Annexin V+ and PI- demonstrating early apoptosis, whereas Q2 shows cell population having Annexin V+ and PI+ demonstrating late apoptosis.
Scanning Electron Microscopy (SEM):
The SEM images were taken for normal and apoptotic cells from the Scanning Electron Microscope as described by Fischer et al., 2012 [23]. The Apoptotic/miRNA treated / control cells were added with freshly prepared 1ml of 2.5 % glutaraldehyde in PBS and incubated at 4ºC for 2-4 hrs. The culture petri dishes were thoroughly rinsed with PBS, three times for 10 minutes each. After primary fixation of Glutaraldehyde, 1 ml of 1% osmium tetroxide in dH2O was added and incubated at room temperature for 1 hr. The cells were thoroughly rinsed with PBS, three times for 10 minutes each; then, cells were dehydrated through graded concentration of Acetone (30, 50, 70, 90, 95, and 100 %) for 5-15 minutes each. Then the cells were dried in a desiccator overnight. The samples were individually mounted on double-sided carbon tape, which was attached to a metal stab. These stabs were coated with electrically conducting metal, i.e., platinum, using a Sputter coater (JFC 1600; JEOL, Tokyo, Japan) at 20mA. The images were taken at different magnifications, i.e., 200X, 800X and 4000X, through Scanning Electron Microscope (JOEL-JSM6490LV).
qRT-PCR: HEK293T were harvested and total RNA was extracted using Pure Link RNA mini kit (Invitrogen, USA Cat No: 12183018A) according to the manufacturer’s instruction. cDNA was synthesized using 1 μg total RNA using Proto Script® II First Strand cDNA Synthesis Kit (New England Biolabs Inc, USA Cat no: E6560S) as per the manufacturer instructions. qRT-PCR for MOAP1 was carried out using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems Cat No: A25742). All the primers were procured through IDT technologies, USA with following sequences: MOAP1; F- 5' CACGAGCACTAGATCACGGCTGCTGGA 3' and R- CTGCCACACAGCAGCTCTGGGAGATGCC 3' [24], GAPDH; F- 5' ACATCGCTCAGACACCATG 3' and R- 5' TGTAGTTGAGGTCAATGAAGGG 3' [25]. The reactions were performed in an Agilent Aria Mx Real-Time PCR machine. The PCR conditions were as follows: UDG activation at 50ºC for 2 min, Hot start (Activation of SYBR Green) at 950C for 2 min followed by denaturation at 950C for 15 sec, annealing at 600C for 1 min for 40 cycles along with the melt curve analysis as per the machine protocol. To confirm specific amplification of the PCR product, dissociation curves were checked routinely, and fluorescence was measured continuously. The relative mRNA expression was normalized to that of GAPDH in the corresponding sample by 2-ΔΔCT. The measurement was done in triplicates, and the results are presented at the means ±SEM.
Dual-luciferase reporter assays: To assess the ability of hcmv-miR-UL70-3p for binding with the 3’ UTR of MOAP1, these assays were performed. Briefly, HEK293T cells were seeded in a 12-well plate (3 × 105 cells/well), and after 24 hrs, they were transfected along with 30nM of miR-UL70-3p mimic; its inhibitors; both wild and deleted 3'UTR of MOAP1 cloned in pEZX-MT-06 vector using lipofectamine 3000 (Invitrogen) in triplicate wells. Luciferase activity was measured using the Dual-Luciferase Reporter assay system No E1910 (Promega Corporation, Madison, WI) in GloMax® Navigator Luminometer System, Promega as per manufacturer’s protocol at 24 hrs post-transfection. All measurements were done in triplicate wells, and signals were normalized for transfection efficiency against the Renilla control. Data from three independent repetitions were presented as the mean ±SEM for the statistical analysis.
SDS-PAGE and Western blotting:
MOAP1 protein downregulation by hcmv-miR-UL70-3p was assessed by performing western blotting. Total protein from the different groups of samples (HEK293T cells) was extracted with the RIPA cell lysis buffer as per the protocol; protein quantification was done with the Bicinchoninic Acid (BCA) Protein Assay kit (G Biosciences, USA Cat No 786-570). The extracted proteins were separated by 10% acrylamide gel and transferred on the Immobilon-PVDF membrane (Millipore, Billerica, Massachusetts, USA). Western Blot analysis was performed using the primary antibody of MOAP1 (Novus Biologicals Cat No H00064112-M02) and its HRP conjugated secondary antibody (Santa Cruz Biotechnologies; Cat Nosc-516102) and β-actin primary antibody (Cell Signalling Technology Cat No 4970S) and the HRP conjugated secondary antibody (Cell Signalling Technology; Cat No 7074S). The immunoblot was visualized using an enhanced chemiluminescence detection kit (Amersham, GE Healthcare, USA), and the developed blots were observed using Chemiscope (Clinx, China). The detections were repeated in three independent experiments. The density of each protein band was read and quantified using Image J software ver 1.53e.
Statistical Analysis: Statistical analysis was performed using Graph Pad Prism 7.0. Software Inc (Graph Pad Software, San Diego, California, USA). Results are represented as mean ± SEM (Standard Error Mean) of at least three independent experiments unless stated otherwise. For simple comparisons, a two-tailed Student’s t-test was used, and for multiple comparisons, two-tailed ANOVA was used. P-value inferior to 0.05 were considered as statistically significant (n=3).
Apoptotic induction and evaluation: Apoptosis was induced in HEK293T cells by treatment with H2O2 as described in Xiang et al., 2016 [26]. The brief outline for the procedure is different, as outlined below in fig1.