Cell culture and treatment
The human pancreatic ductal epithelial cell line HPDE6-C7 (Guangzhou Jenniobio Biotechnology, Guangzhou, China) was cultured in DMEM medium (Gibco, USA) supplemented with 10% fetal bovine serum (Lonsera, Uruguay), 1% L-glutamine (Solarbio, Beijing, China), and 1% penicillin-streptomycin mixture (Solarbio, Beijing, China) at 37°C in a humidified atmosphere of 5% CO2. Cells were grown on coverslips (24 mm × 24 mm) in 6-well plates or 25-cm2 flasks. Cells were silenced for GSN, treated with 100 nM CAE (Sigma-Aldrich, USA) and 2.5 mM TG (T9420, Solarbio, Beijing, China) for 24 h, and divided into 12 groups according to the type of transfection and treatment, as follows: blank control group (BC) (cells without lentiviral transfection), CAE-treated BC group (CAE), TG-treated BC group (TG), CAE + TG-treated BC group (CAE + TG), negative control group (NC) (transfected with an empty vector), CAE-treated NC group (NC + CAE), TG-treated NC group (NC + TG), CAE + TG-treated NC group (NC + CAE + TG), knockdown group (KD) (GSN-silenced), CAE-treated KD group (KD + CAE), TG-treated KD group (KD + TG), and CAE + TG-treated KD group (KD + CAE + TG).
RNA interference-mediated GSN gene silencing
Three pairs of complementary oligonucleotide sequences were designed and synthesized according to GSN CDS sequences. Three double-stranded RNAs converted from complementary sequences were cloned into a pcDNA6.2-GW/EmGFP-miR plasmid vector (R&S Biotechnology, Shanghai, China). The cloned DNA fragments were amplified by PCR and subcloned into the pLenti6.3/V5-DEST vector (R&S Biotechnology, Shanghai, China). The recombinant plasmid and lentiviral packaging mix (Invitrogen; Thermo Fisher Scientific Inc., Waltham, Massachusetts) were transiently co-transfected into 293T cells (R&S Biotechnology, Shanghai, China). Recombinant lentivirus-infected HPDE6-C7 cells with the highest degree of GSN silencing were selected by qRT-PCR screening and validation.
Intracellular calcium measurement
HPDE6C7 cells were grown on 60 mm culture dishes until they reached 60–65% confluence. Cells were washed with Hanks’ balanced salt solution without calcium, magnesium, and phenol red (D-HBSS, H1046, Solarbio, Beijing, China) three times and were loaded with Calcium Crimson (C3018, Invitrogen; Thermo Fisher Scientific, Inc, Waltham, Massachusetts) (5 µM, 1.0 mL per dish) at 37 °C for 30 min in the dark. After that, cells were washed with D-HBSS three times and stained with Hoechst 33258 (H3569, Invitrogen; Thermo Fisher Scientific, Inc., Waltham, Massachusetts) (30 µg/mL, 1.0 mL per dish) at 37 °C for 20 min in the dark. Fluorescence in the cytosol and nucleus was measured at 530–550 nm and 460–495 nm, respectively, under an inverted fluorescence microscope.
Transmission electron microscopy (TEM)
Control and GSN-silenced HPDE6-C7 cells were cultured in 25-cm2 flasks until they reach 70–80% confluence. Cells were harvested using a cell scraper, centrifuged at 1500 rpm for 10 min, fixed in 3% glutaraldehyde for 2.5 h at 4°C, and washed with PBS (10 mM) three times for 10 min each time. After that, the samples were fixed in 1% osmium for 2 h at 4°C, washed with PBS three times for 10 min each time, dehydrated through a graded ethanol series, embedded in epoxy resin, and cut into 70 nm slices. Samples were stained with 3% uranium acetate-lead citrate. Ultrastructural changes in tight junctions
(TJs) were analyzed by TEM.
Western blotting
Proteins from HPDE6-C7cells were lysed in RIPA buffer (Solarbio, Beijing, China) containing 1% phenylmethylsulfonyl fluoride (PMSF) (Solarbio, Beijing, China) on ice for 30 min and centrifuged at 12,000 rpm at 4°C for 20 min. Protein concentration was determined using a bicinchoninic acid protein assay kit (P0012, Beyotime, Shanghai, China). Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and electrotransferred onto polyvinylidene fluoride membranes. Membranes were blocked with 5% non-fat milk for 1 h and incubated with primary antibodies against GSN (1:1000, ab74420, Abcam, Cambridge, UK), ZO-1 (1:1000, 21173-1-AP, Proteintech Group, Wuhan, China), nectin-2 (1:1000, ab135246, Abcam, Cambridge, UK), E-cadherin (1:1000, 20874-1-AP, Proteintech Group, Wuhan, China), occludin (1:1000, 27260-1-AP, Proteintech Group, Wuhan, China), and GAPDH (1:10000, ab181602, Abcam, Cambridge, UK) overnight at 4°C, and then incubated with DyLight 680-conjugated secondary anti-rabbit antibody (1:10000, 5366, Cell Signaling Technology) for 1 h at room temperature (RT) in the dark. Immunoreactive bands were imaged using the Odyssey infrared imaging system, and fluorescence intensity was quantified using Image J software.
Quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA was isolated from HPDE6-C7 cells using RNAiso Plus (9108, TaKaRa Bio Inc, Japan) and converted to cDNA by reverse transcription using PrimeScript RT reagent Kit with gDNA Eraser (RR047B, TaKaRa Bio Inc, Japan). qRT-PCR was performed using TB Green Premix Ex Taq II (RR820B, TaKaRa Bio Inc, Japan) and corresponding primers (Table 1). The relative expression levels of target genes were measured using the 2− ΔΔCt method.
Table 1
Target gene primers used in qRT-PCR
Gene | Forward primer (5’ to 3’) | Reverse primer (5’ to 3’) |
GAPDH | ACATCGCTCAGACACCA | GTAGTTGAGGTCAATGAAGGG |
GSN | AGCTGGCCAAGCTCTACAAG | TGTTTGCCTGCTTGCCTTTC |
E-cadherin | AGGATGACACCCGGGACAAC | TGCAGCTGGCTCAAGTCAAAG |
Nectin−2 | ACCTGCAAAGTGGAGCATGAGA | CCGGAGATGGACACTTCAGGA |
ZO−1 | ATAAAGTGCTGGCTTGGTCTGTTTG | GCACTGCCCACCCATCTGTA |
Occludin | AGTGCCACTTTGGCATTATGAGA | CTTGTGGCAGCAATTGGAAAC |
Immunofluorescence staining of actin filaments
Cells were plated onto coverslips (24 mm × 24 mm) in 6-well plates until they reached 55–60% confluence. The cells were fixed in 4% paraformaldehyde for 15 min at RT, permeabilized in 0.1% Triton X-100 for 5 min, blocked in PBS containing 2% bovine serum albumin (Solarbio, Beijing, China) for 20 min at RT, and stained with tetramethyl rhodamine isothiocyanate-phalloidin (100 nM, 50 µL per well, Solarbio, Beijing, China) for 30 min at RT in the dark. The samples were washed with PBS three times at 5-min intervals between each step and mounted with anti-fading medium containing DAPI (S2100, Solarbio, Beijing, China) for 3 min at RT in the dark. Actin filaments were observed at 530–550 nm, and cell nuclei were observed at 460–495 nm under an upright fluorescence microscope. Images were analyzed using Image J software.
Fluorescein isothiocyanate (FITC)–dextran fluorescence
HPDE6-C7 cell suspensions (2 × 105 cells/transwell) were cultured on microporous polycarbonate membranes (0.4 µm pore size) to full confluence in the upper compartment of 12-well transwell plates (#3401, Corning). The culture medium in the upper compartment was removed, and adhered cells were washed with PBS twice. After that, FITC-dextran (4 kDa, Sigma-Aldrich, USA) (0.5 mg/mL, 500 µL/transwell) was added to the upper compartments, and PBS (1 mL/transwell) was added to the lower compartment. The plates were incubated in the dark for 60 min at 37 °C. Fluorescence in PBS was measured in a microplate reader (excitation, 495 nm; emission, 520 nm) and quantified using a calibration curve of FITC-dextran.
Statistical analysis
The results were expressed as means and SEM. Statistical analysis was performed by one-way analysis of variance using SPSS Statistics version 22.0, GraphPad Prism version 6.0, and Image J. P-values smaller than 0.05 were considered statistically significant.