This project was carried out with the permission of the Ethics Committee of the Ningbo No. 6 Hospital (registered number 2015-018).
Cell culture and treatments
Five female C57BL/6 mice (4-week-old) were used and euthanized to obtain BMSCs cultured according to a previous work [43]. In brief, the mouse femur was collected and the surrounding soft tissues were removed. Then, the bone marrow in the femur was washed three times with α-MEM (Sigma-Aldrich). The obtained bone marrow content was placed in a dish containing a complete medium consisting of a medium supplemented with 100 U/ml penicillin, 100 mg/ml streptomycin sulphate, and 10% FBS (Sigma-Aldrich). BMSCs were incubated at 37 °C in a 5% carbon dioxide incubator. The third generation of BMSCs was used for our experiments. When the confluence reached 70%, the osteogenic medium was added to allow the osteogenic differentiation. The osteogenic medium consisted of complete medium supplemented with 0.1 mM dexamethasone (Sigma-Aldrich), 5 mM β-glycerophosphate (Sigma-Aldrich), and 100 mM ascorbic acid (Sigma-Aldrich). Then BMSCs were cultured for 14 days under the osteogenic environment, changing the medium every 3 days.
The silencing of β-catenin and BMP 2 gene was performed according to previous investigations [44, 45]. The transfection sequences were the following: β-catenin, former primer 5’-AAGGTAGAGTGATGAAAGTTGTT-3’ and reverse primer 5’- CACCATGTCCTCTGTCTATTC-3’. BMP2, former primer 5’-AGGGTTTCAGGTCAGTTTCCG-3’ and reverse primer 5’-GATGATGAGGTTCTTGGCGG-3’. The cDNA of β-Catenin and BMP2 were transferred into ad lentivirus of Cre recombinase (Ad-Cre; System Biosciences, Hercules, CA, USA). BMSCs at a density of 1.0 × 105 cells/well were seeded into 6-well plates for 24 hours. Next, the cells cultured in the osteogenic medium and transferred with the Ad-Cre (at a concentration of 5 × 108 pfu/mL) for 48 hours. Ad-GFP was used as a control. Next, the cells were treated with 40 µm GEN in the osteogenic medium for 7 days. Finally, the expression of Runx2, OSX, OCN, OPN, BMP2, and β-catenin were evaluated by qPCR and Western blotting.
Cell cytotoxicity test
BMSCs (1.0 × 103 cells/well) were seeded into 96-well plates and cultured for 24 hours. Then, GEN at different concentrations (0, 10, 20, 40, and 80 µM) was added, and the cells were cultured for 7 days. At the end of the 7 days, the Cell Counting Kit-8 (CCK-8; Sigma-Aldrich) was used to evaluate the cytotoxicity of GEM The absorbance was measured at 450 nm according to the manufacturer recommendations. A previous study described this method in detail [31].
Alkaline phosphatase activity measurement
BMSCs (1.0 × 105 per well) were seeded into 6-well plates, and then treated with GEN at different concentrations (0, 10, 20, and 40 µM) for 14 days under osteogenic environment. Next, BMSCs were washed with medium for three times and lysed by ultrasound. The concentration of the lysate protein was measured by the Bradford protein test (Thermo Fisher Scientific, Waltham, MA). Alkaline phosphatase (ALP) activity was detected using p-nitrophenyl-phosphate in AMP buffer (Sigma-Aldrich) at room temperature for 20 minutes. Then, sodium phosphate (0.3 M, pH 12.3, Sigma) was used to terminate the reaction. Finally, the results of ALP activity were standardized according to the protein concentration. Next, BMSCs were fixed with formalin for 10 minutes, ALP staining buffer (Sigma-Aldrich) was added, and the cells were incubated for 30 minutes at room temperature.
Alizarin red staining
BMSCs (1.0 × 105 per well) were seeded into 6-well plates, and treated with GEN at different concentrations (0, 10, 20, and 40 µM) for 14 days under osteogenic environment. Next, the medium was discarded, the cells were washed with PBS for three times, and a formalin solution was added to fix the cells. After 20 minutes, the formalin was discarded, BMSCs were washed 2 times with medium, and treated with alizarin red solution (Sigma-Aldrich) for 30 minutes. Subsequently, the stained cells were observed under an optic microscope and images were taken in random fields. Finally, the software Image J (NIH, Bethesda, MA, USA) was used to perform the statistics of the mineralized nodules, and the nodules larger than 0.04 mm were included in the statistical calculation [46].
Quantitative PCR (q-PCR)
BMSCs (1.0 × 105 cells/well) were seeded into 6-well plates, and treated with GEN at different concentrations (0, 10, 20, and 40 µM) in the osteogenic medium for 14 days. Then the mRNA expression of ALP, OPN, OCN, OSX, Runx2, and BMP2 was detected by q-PCR. Trizol reagent (Sigma-Aldrich) was used to extract the RNA from BMSCs. The total RNA was translated into cDNA according to the reverse-transcribed kit (Applied Biosystems, USA) using the following parameters: 95 °C for 9 minutes, 36 °C for 40 minutes for 2 cycles, then 86 °C for 4 minutes, and final cooling to 4 °C. The cDNA of the target gene was quantified by q-PCR using the SYBR Green Premix kit (Roche, Switzerland). The q-PCR parameters were the following: 95 °C for 20 seconds, 90 °C for 10 seconds for 40 cycles, and 60 °C for 30 seconds. The primers used in this study (Life Technologies) were the following: ALP, forward primer AACCCAGACACAAGCATTCC, reverse primer GAGAGCGAAGGGTCAGTCAG. Runx2, forward primer AATTAACGCCAGTCGGAGCA, reverse primer CACTTCTCGGTCTGACGACG. OSX, forward primer CACTTCTCGGTCTGACGACG, reverse primer CACTTCTCGGTCTGACGACG. OCN, forward primer CACTTCTCGGTCTGACGACG, reverse primer ATAGCTCGTCACAAGCAGGG. BMP2, forward primer GCTTCCGTCCCTTTCATTTCT, reverse primer GCTTCCGTCCCTTTCATTTCT. OPN, forward primer GCTTCCGTCCCTTTCATTTCT, reverse primer GCTTCCGTCCCTTTCATTTCT. GAPDH, forward primer CATCACTGCCACCCAGAAGAC, reverse primer CCAGTGAGCTTCCCGTTCAG. GAPDH was used as the internal control. The relative gene expression was calculated using the 2−ΔΔCt method.
Western blot
BMSCs (1.0 × 105 cells/well) were seeded into 6-well plates, and treated with GEN at different concentrations (0, 10, 20, and 40 µM) in the osteogenic medium for 14 days. To assess the influence of GEN on the signalling of BMP and Wnt/β-catenin, BMSCs were treated with either 300 ng/mL Noggin (Sigma-Aldrich) or 100 ng/ml DKK-1 (Sigma-Aldrich) in the treatment with GEN for 2 weeks. After the treatment, the total BMSC proteins were extracted by radioimmunoprecipitation assay lysis buffer (Sigma-Aldrich) at 4 °C for 30 minutes. After centrifugation, the supernatant was collected, the proteins were separated by electrophoresis and transferred to a PVDF membrane according to a previous study (Xiao et al. 2015). The primary antibodies used in this work were the following: anti-BMP-2 (1:2000; Sigma-Aldrich), anti-β-catenin (1:1500; Cell Signaling Technology), anti-phospho-Smad1/5/8 (1:5000; Sigma-Aldrich) anti-β-actin (1:3000; Cell Signaling Technology), anti-Runx2 (1:800; Cell Signaling Technology), and anti-OCN (1:800; Cell Signaling Technology). Next, the PVDF membrane was washed by TBST thrice, each time for 5 minutes and the second antibody goat anti-rabbit (1:3000, Abcam) was added. The specific protein bands were visualized using a proprietary chemiluminescence kit (PerkinElmer, Inc, Waltham, MA). The bands were quantified by densitometry using the Image-Pro Plus 6.0 software (Media Cybernetics, Rockville, MD).
Experimental model and animal groups
Thirty-six female C57BL/6 mice (8-week-old, 21 ± 2 g) were obtained from the animal experimental centre of the Southern Medical University (Guangzhou, Guangdong, China). The experimental mice were stochastically divided into three groups: Sham group (n = 12), ovariectomized (OVX) group (n = 12) and OVX + GEN group (n = 12). The OVX + GEN groups were treated by an oral gavage of 50 mg/kg/day GEN during these 3 months. The Sham group and OVX group received the same dose of saline by oral gavage. After 3 months, the experimental mice were euthanized by cervical dislocation and the femurs were collected for further studies.
Histological and immunohistochemical staining
The femur was immersed in 4% paraformaldehyde for 48 hours and decalcified using 15% ethylenediaminetetraacetic acid for 14 days. Then, they were dehydrated, paraffin embedded, and cut into 4 µm-thick sections. To perform the haematoxylin–eosin (HE) staining, the sections were dewaxed, hydrated, and stained with HE dyes (Abcam). Finally, the HE stained sections were photographed and analysed. As regard the immunohistochemistry, the sections were dewaxed, hydrated, treated with 3% hydrogen peroxide for 15 minutes and with protease K for 10 minutes. Next, the sections were treated with primary antibodies and incubated overnight at 4 °C. The primary antibodies (Santa Cruz Biotechnology) used were the following: anti-Runx2 (1:200), anti-BMP-2 (1:200), and anti-OCN (1:200). The sections were washed with PBS thrice for a total of 15 minutes and the second antibody was added and incubated for 50 minutes. Next, the sections were washed three times with PBS, and then diaminobenzidine solution was added to obtain the chromogenic reaction. Finally, the sections were observed and analysed under an optical microscope.
Microcomputer tomography analysis
The collected femurs were preserved in 4% paraformaldehyde for 48 hours. The prepared femur was scanned and analysed by high-resolution micro CT (Caskaisheng, China). The scanning parameters of the micro-CT were set as follows: 80 kV, 15 µA, and a scanning thickness of 20 µm. The area below the crud end of femoral shaft was chosen as the analysis area for statistical analysis [47]. The bone parameters for statistical analysis included the following three indexes: trabecular bone mineral density (BMD), trabecular number, and trabecular thickness.
Statistical analysis
Statistical analysis was performed using GraphPad Prism 6 (Manufacturer, La Jolla, CA, USA). All in vitro experiments were repeated three times, and each experiment was carried out in triplicate. In the in vivo experiments, each group contained at least 6 rats. Results were expressed as mean ± standard deviation (SD). One-way ANOVA and Dunnett’s test were used to compare multiple groups, while unpaired Student’s t-test was used for the comparison of two groups. P < 0.05 was considered statistically significant.