Experimental animals
A total of 52 adult male Sprague–Dawley (SD) rats (280–300 g) were purchased from Shanghai SLAC Laboratory Animal Co. Ltd. The rats were kept in a humidity-controlled room (25 ± 1 °C, 60%-70% humidity, and with lights between 7:00 a.m. and 7:00 p.m.) and were given free access to food and water. All rats were cared for in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80-23) revised 1996. All study procedures were approved by the Fujian Medical University Institutional Animal Care and Use Committee.
SCI model
The experimental SCI model was established in rats by the modified weight-drop method as previously described[40]. Briefly, before SCI, rats were anesthetized with intraperitoneal injections of 10% chloral hydrate (300mg/kg, b.w.) and then fixed on the operating table in the prone position. There is no rat exhibited signs of peritonitis, pain or discomfort following administration of 10% chloral hydrate. A 3 cm midline incision was made at the level of the T12 vertebra to fully expose the vertebrae and perform laminectomy using tissue scissors. Then, a 10g impactor device with a diameter of 2 mm was dropped freely at a height of 2.5 cm to completely impact the spinal cord, then it was immediately removed to form an injury area of a specific size. After being impacted, the rats will have tail sway reflex and twitching and contraction of both hind limbs and body. Which is the stress reflex of the rats, and indicates that the SCI model was successfully performed. The rats in the sham operation group underwent the same surgical procedure as the SCI group, except that they did not suffer spinal cord impact. After the operation, the urinary bladder of the rats (excluding those in the sham group) underwent manually emptied twice a day to assist in urinating until the rats were able to urinate normally.
Experimental groups and drug treatments
Rats were randomly divided into the following five groups and drug administration was performed by an investigator who was blind to the drugs. NGR1 was freshly dissolved in vehicle (DMSO and 0.9% NaCl, 1:3) and given at a dose of 25 mg/kg. ML385 (Nrf2 inhibitor) was freshly dissolved in vehicle (DMSO and 0.9% NaCl, 1:3) and given at a dose of 30 mg/kg. The administration dose of NGR1 and ML385 was selected according previously described[32, 16].
- Sham + vehicle group: Rats were treated with the same amount of vehicle (DMSO and 0.9% NaCl, 1:3) by intraperitoneal injection (i.p.) every day for a total of 3 days (n = 30).
- Sham + NGR1 group: Rats were treated with NGR1 (25 mg/kg/day, i.p.) for a total of 14 days (n = 30)
- SCI + vehicle group: The rats were administrated with the same amount of vehicle (DMSO and 0.9% NaCl, 1:3, i.p.) every day for a total of 14 days two hours after SCI (n = 30).
- SCI + NGR1 group: The rats were administrated with NGR1 (25 mg/kg/day, i.p.) for a total of 14 days two hours after SCI (n = 30).
- SCI + NGR1 + ML385 group: After contusion, the rats were immediately injected with NGR1 (25 mg/kg/day, i.p.) and ML385 (30 mg/kg/day, i.p.) for a total of 14 days two hours after SCI (n = 30).
Locomotion recovery assessment
The recovery of behavioral function was assessed using the Basso-Beattie-Bresnahan (BBB) Locomotor Scale at 1, 3, 7, 14, and 21 days following surgery procedures as previously described[23]. Briefly, rats were placed individually in an open field and observed for 4 minutes by two observers who were blind to the experiment. The scores of rats from each group (n=6) were recorded and the data used for analysis were represented as mean scores. BBB scores were graded on a scale of 0–21 (0, complete paralysis; 21, normal locomotion).
Tissue preparation
Rats were anesthetized with intraperitoneal injections of 10% chloral hydrate (300mg/kg, b.w.) at day 14 after SCI. An incision was made at the midline of the sternum to expose the heart, and 0.9% pre-cooled saline was slowly perfused trans cranially. About 1cm of spinal cord tissue samples surrounding the damaged region were obtained on ice. For biochemical analysis, the samples were immediately transferred to liquid nitrogen and stored at a refrigerated temperature of about -80°C. For histopathological analysis, the samples were fixed in 4% paraformaldehyde at 4°C overnight and then dehydrated in a 30% sucrose solution and a 20% sucrose solution in turn. The thickness of 10 um spinal cord sections were cut using a cryostat at -20°C for further analysis.
Hematoxylin-eosin staining and Nissl staining
The spinal cord tissue sections were used for HE staining using HE solution according to the manufacturer’s instructions 14 days after SCI. Briefly, after being stained with hematoxylin for 30 s, 10 um tissue sections were quickly washed in deionized water. Then these sections were further differentiated in the HCl/95% alcohol (1:50) solution for 6 s. After being washed in deionized water for 1 h, the sections were continuously stained with eosin and subsequently were fixed with neutral gum after dehydrated using a series of ethanol. These slides then were observed under a microscope and the Image J software was used for analyzing the proportion of preserved tissue as previously described[12].
Nissl staining was conducted according to the manufacturer’s instructions 14 days after SCI. Briefly, the spinal cord sections were dried at room temperature for 2h and then incubated in the ethanol/chloroform mixed solution overnight. The next day, the sections were soaked in 100% ethanol, 75% ethanol and distilled water for 1 minute, and then incubated in 37% 0.1% cresol purple solution for 5 minutes. Then, the sections were immersed in anhydrous ethanol and xylene for another 5 minutes. After being sealed with neutral gum, these slides then were observed under a microscope and the Image J software were used for analyzing the average number of survival neurons of three different visual fields on each slide.
Western blot analysis
The spinal cord tissues obtained 14 days after SCI were homogenized and lysed in RIPA buffer (Beyotime Biotechnology, China) containing PMSF, protease and phosphatase inhibitor cocktails (Beyotime Biotechnology, China) for 30 min on ice. The supernatants of tissue lysates were collected after being centrifuged at 12,000 rpm for 30 min at 4 °C and then the protein concentration was quantified using the BCA Protein Assay Kit (Thermo, USA). A total of 40 μ g protein was separated using sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto PVDF membranes. The membranes were blocked with 5% skimmed milk in TBST for 1.5 h at room temperature. After washing, these PVDF membranes were incubated at 4 °C overnight with the following primary antibodies: anti-Nrf2 (1:1000, Abcam, USA), anti- Heme Oxygenase 1 (1:2000, Abcam, USA), anti-NQO1 (1:1000, Abcam, USA), anti-Cleaved Caspase-3 (1:1000, Proteintech, China), anti-Caspase-9 (1:500, Proteintech, China), anti-Bcl-2 (1:1000, Abcam, USA), anti-Bax (1:1000, Abcam, USA), anti-IL-6 (1:500, Abclonal, China), anti-IL-1β (1:1000, Abclonal, China), anti-TNFα (1:1500, Abclonal, China) and anti-β-actin (1:400, Boster, China). The next day, the membranes were washed with TBST for three times and then incubated with the following secondary antibodies (goat anti-rabbit, 1:10000, Abcam, USA; goat anti-mouse, 1:10000, Abcam, USA) at room temperature for 1.5 h. The immunoreactive bands were visualized using an imaging system (Bio-Rad, USA) and the Image J software was used for measuring band intensity.
RT-PCR analysis
The total RNA from the spinal cord tissues obtained was extracted using Trizol® reagent (invitrogen, USA) 14 days after SCI according to the manufacturer’s instructions. Briefly, cDNA was generated from total RNA (1 μg) using the TaKaRa RNA PCR™ kit (AMV) Ver. 3.0 (Takara, Japan). The mRNA expressions of IL-6, IL-1β, TNF-α, and β-actin were examined using cDNA as a template by the following primers:IL-6 (forward primer 5′- ATACCACCCACAACAGACCAGT-3′ and reverse primer 5′-GATGAGTTGGATGGTCTTGGT -3′); IL-1β (forward primer 5′- CTCTGTGACTCGTCGTGGGATGATG -3′ and reverse primer 5′- CACTTGTTGGCTTATGTTCTGTCC -3′); TNF-α (forward primer 5′- CCCAGACCCTCACACTCAGATCAT -3′ and reverse primer 5′- CAGCCTTGTCCCTTGAAGAGAA -3′; β-actin (forward primer 5′-ATATCGCTGCGCTCGTCG-3′ and reverse primer 5′-CAATGCCGTGTTCAATGGGG-3′). The amplification was done for 27 cycles at 92 °C for 30 s, 50 °C for 30 s and 70 °C for 1min. Final extension was performed at 70 °C for 10 min. The expression of relative mRNA was calculated using the 2-ΔΔCt method.
Immunofluorescence analysis
The sections from the spinal cord tissues acquired 14 days after SCI were used for immunofluorescence staining as previously described with minor modifications. Briefly, the 10um sections were dried for 1h at room temperature and incubated with blocking solution(5% goat serum in PBST) for 2 h at room temperature. Then the sections were incubated at 4 °C overnight with the following primary antibodies: anti-NeuN antibody (1:300, Abcam, USA), anti-Nrf2 (1:100, Abcam, USA). The next day, after being washed three times with PBS, the sections were incubated with the following secondary antibodies (488 goat anti-rat IgG, 1:500, Invitrogen, USA; 594 goat anti-mouse, 1:500, Invitrogen, USA) for 2h at room temperature. The sections were then incubated with DAPI for 15 min and sealed with a coverslip. The images were visualized using a fluorescent microscopy (Olympus, Japan). the Image J software was used for analyzing the overlap coefficient of HO-1 with neurons.
TUNEL staining analysis
The sections were used for TUNEL staining 14 days after SCI using an In Situ Cell Death Detection kit (Roche, Germany) according to the manufacturer’s instructions. Briefly, rewarmed sections were fixed in 4% paraformaldehyde and incubated with 2% H2O2. After being washed three times, the sections incubated with reaction mixture solution for 2h at 37°C and then blocked with 2% BSA for 1h. Finally, the sections were counterstained with hematoxylin. The images were visualized using a fluorescent microscopy (Olympus, Japan) and the Image J software was used for counting TUNEL-positive cells.
Measurement of antioxidants and oxidative products
The spinal cord tissues obtained 14 days after SCI were lysed with RIPA buff and the levels of spinal malonaldehyde (MDA), superoxide dismutase (SOD), and glutathione peroxidase activity (GSH-PX) were measured by the MDA assay Kit (NanJing JianCheng Bioengineering Institute, China), the SOD assay Kit (NanJing JianCheng Bioengineering Institute, China), and the GSH-PX assay Kit (NanJing JianCheng Bioengineering Institute, China) according to the manufacturer’s instructions.
Statistical analysis
Data were presented as mean ± SEM and processed by SPSS 22.0. statistical software. Comparisons among multiple groups were performed by one-way ANOVA, followed by Turkey’s post hoc tests. The significance of the BBB scores was analyzed by two-way repeated-measures ANOVA), followed by Bonferroni post hoc test. P-values < 0.05 were considered statistically significant.