2.1 Study participants
All participants were recruited at the Affiliated Hospital of Jiangsu University, Jiangsu, China. Approval for the study was obtained from the Clinical Research Ethics Committee, Affiliated Hospital of Jiangsu University. All methods were carried out in accordance with relevant guidelines and regulations. A total of 60 age- and sex-matched participants were recruited for this study. Based on body mass index (BMI), all subjects were divided into 2 subgroups: normal-weight (NW: BMI<25 kg/m2, n=30) and obesity(OB: BMI≥25 kg/m2, n=30) [19]. In this study, we excluded subjects with any of the following: acute complications of diabetes, secondary obesity, acute and chronic inflammatory diseases, systemic corticosteroid treatment, renal dysfunction, or hepatic dysfunction. Women who were currently pregnant, breastfeeding, or taking a contraceptive pill were also excluded from the study.
2.2 Measurement of EDA concentrations and biochemical parameters
Serum EDA levels were determined using a commercially available human enzyme-linked immunosorbent assay (ELISA) (Wuhan Eiaab Science Co., China; Catalog No. E1976h). The sensitivity of the kit was less than 20pg/ml, the intra assay CV was≤ 7.8%, and the inter assay CV was≤8.9%. The detection range of ELISA was 78-5000 pg/mL.
Clinical and biochemical evaluations were performed as described previously [20]. Height and weight were measured using standardized techniques. BMI was calculated as body weight (kg) divided by square of height (m) and the waist-to-hip ratio (WHR) was calculated by the ratio of waist circumference (WC) to hip circumference (HC). Participants were told to avoid stressful activities (sports and physical exercise) before blood collection. Blood samples were obtained from each subject after overnight fasting. Serum samples were separated and not frozen for biochemical analysis. Fasting plasma glucose (FPG) was determined by a glucose oxidase-based assay and fasting insulin (FINS) was measured by chemiluminescence. Hemoglobin A 1c (HbA1c) was determined using HPLC. The levels of TG, total cholesterol (TC), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C), ALT and AST were detected by enzymatic method and glutamyl transpeptidase (GGT) was determined by γ-glutamine-3-carboxyl-4-nitroaniline method. To estimate insulin sensitivity and β-cell function, the homeostasis model assessment (HOMA) was used: HOMA of insulin resistance (HOMA-IR) =FINS (milliunits per liter) ×FPG (millimoles per liter)/22.5, HOMA of β-cell function (HOMA-β) =20×FINS/(FPG-3.5).
2.3 Animals and experimental design
Twenty-four healthy male C57BL/6J mice, four weeks of age, were maintained in a room with controlled lighting (12 hours light/dark cycle) and regulated temperature (23±2◦C) and humidity (50-60%). All mice were fed with free access to food and water for 1 week to be adapted for the environment. After 1 week of acclimation, eight mice were randomly fed with regular chow as normal control group (NC group) and throughout the study, while the remaining mice were fed with HFD (HFD: 36% carbohydrate, 19% protein and 45% fat) for 20 weeks. Then, the HFD animals were randomly divided into two groups: HFD+saline group (HFD group), or liraglutide (LIRA, Victoza, Novo Nordisk)-treated group (HFD+LIRA group). They were received daily subcutaneous injections with either liraglutide (0.2 mg/kg daily) or the same volume of saline at about 12.30pm for 12 weeks and normal chow mice were given saline injections during the same period. The body weight of all mice measured every 2 weeks.
At the end of the experiment, the mice were fasted overnight and euthanized using 1% sodium pentobarbital (50 mg/kg). Eyeballs were removed and blood samples were collected and serum was obtained by centrifugation at 3,000 rpm at 4◦C for 20min. Tissues collected were either immediately fresh frozen in liquid nitrogen after dissection and stored at -80 °C until further processing or were fixed in 4% paraformaldehyde (PFA) solution in PBS.
2.4 Cell culture and insulin resistance models
Alpha mouse liver 12 (AML12) cells were obtained from cell bank of Chinese Academy of Science, Shanghai., and maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco) with 25 mM glucose, 10% fetal bovine serum (FBS) (Gibco), penicillin (100 units/ml), streptomycin (100 μg/ml) (Sigma), insulin, transferrin and selenium (ITS) (Sigma) and dexamethasone (40 ng/ml) (Sigma) at 37◦C in a humidified atmosphere of 95% air and 5% CO2. To induce insulin resistance and lipid metabolism disorder, AML12 cells were incubated with 0.25 mM palmitic acid (PA) with 0.2% bovine serum albuminin (BSA) for 24h in serum-free medium and cells were treated with different concentrations of liraglutide (10nM,100nM,1000nM) in the presence of PA.
2.5 Biochemical analyses of animals’ serum
Serum blood glucose, TC, TG, LDL-C, as well as AST and ALT activities were examined by sop of Beckman Coulter Biochemical Analyzer (AU5800, USA).
2.6 Insulin tolerance test and glucose tolerance test
The insulin tolerance test (ITT) and glucose tolerance test (GTT) were performed as previously described [21, 22]. Briefly, in ITT and GTT, mice were starved for 4 h and 16 h respectively, and then insulin (0.75 units/kg) or glucose (2.0 g/kg) were injected intraperitoneally. Accu-check glucometer (Sandhofer Strasse 116,68305 Mannheim, Germany) was used to measure the blood glucose levels in the tail vein. Blood glucose was measured before injection (time 0) and at 15, 30, 60, 90, 120 min after injection in ITT, and before injection (time 0) and at 30, 60, 90, 120 min after injection in GTT.
2.7 Tissue histology and liver triglyceride assay
The sections of liver tissues were fixed in 4% PFA, embedded in paraffin and sliced (4μm). Hematoxylin and eosin (HE) staining was performed according to the standard procedure, and imaged under a light microscope (Nikon, Japan). Hepatic lipid accumulation was also determined using Oil Red O staining. The imaging system was used to collect the images on the tissue staining section, and the analysis software was used to automatically read the tissue measurement area, calculate the positive area and tissue area in the measurement area, and calculate the proportion of the positive area (Servicebio, China). Intrahepatic (mice) TGs were measured using a TG assay kit (Jiancheng Bioengineering Institute, Nanjing, China).
2.8 Quantitative real-time PCR
Total RNA was isolated from cells or livers using TRIzol Reagent (Invitrogen) followed by the manufacturer’s guidelines and cDNA was generated with PrimeScript RT-PCR Kit (Vazyme Biotech, Nanjing, China). PrimeScript RT-PCR Kit (Vazyme Biotech, Nanjing, China) was used for measuring relative mRNA expression by quantitative real-time PCR (Quant Studio 5). EDA gene expression levels were normalized to β-actin levels. The sequences of primers (Sangon Biotech, Shanghai, China) used in the study were listed as followed: EDA, forward TGAATAGCAGCCCATTAGTAGG and reverse CAGAGAATAAATGGCATTGGCA; 𝛽-actin, forward TGGAATCCTGTGGCATCCATGAAAC and reverse TAAAACGCAGCTCAGTAACAGTCCG.
2.9 Western blot analysis
Total proteins were extracted from livers and cells by with ice-cold RIPA lysis buffer (Beyotime, Shanghai, China) and quantified with BCA kits (Beyotime, Shanghai, China). The denatured protein was loaded and separated on a 10% SDS-PAGE gel, transferred onto PVDF membranes, and then blocked with 5% non-fat milk in Tris-buffered saline for 1h. Subsequently, the membranes were incubated with the EDA (Abcam) and β-actin (CST) primary antibody overnight at 4°C. The following day, appropriate secondary antibodies conjugated to horseradish peroxidase were incubated with respective membranes for 1h at room temperature. The bands were detected by enhanced chemiluminescence (ECL) method using kit (Vazyme Biotech, Nanjing, China). The relative expression of target protein was normalized to that of β-actin. Protein band densities were quantified using ImageJ.
2.10 Statistical analysis
All statistical analyses were performed using SPSS 25.0. Data are presented as mean ± standard deviation (x ±SD) for normally distributed variables and percentage (n%) for categorical variables. Data were tested for normality before the use of a parametric test. Independent student t test was used for comparison between the two groups. One-way ANOVA were used for multiple comparisons. Categorical variables were compared by χ2 test. Relationships between EDA and other parameters were examined by calculation of Pearson correlation coefficients and Spearman correlation coefficients. Multivariate regression models were fit for EDA as a dependent variable to demonstrate the relative contribution of these parameters to the outcome ones after collinearity diagnostics. Drawing with software of GraphPad Prism 9.0 (GraphPad software, Inc., La Jolla, CA, USA). P<0.05 was considered significant.