2.1 Reagents
Leonurine from Fudan University (Courtesy of Zhu Yizhen's Research Group), Losartan Potassium Tablet (Sichuan Hairong Pharmaceutical Co. Ltd), RNA preservation solution (Beijing Solaibao Biotechnology Co., Ltd), HE staining kit( Beijing Solaibao Biotechnology Co., Ltd), Ca2+ Content Kit( Nanjing Jiancheng Institute of Biological Engineering), Angiotensin Ⅱ kit (nanjing institute of biological engineering), Angiotensin Ⅱ receptor 1 kit (wuhan eli rhett biotechnology co., LTD), BCA Protein Quantitative Kit (Beijing Kangwei Century Biotechnology Co., Ltd), Animal total RNA rapid extraction kit (Chengdu Fuji Biotechnology Co., Ltd), RT EasyTM II (Chengdu Fuji Biotechnology Co., Ltd), EasyTM (Chengdu Fuji Biotechnology Co., Ltd), ANF Primer (Shanghai Sangon Biotechnology Technology Service Co., Ltd), β-MHC primer (Shanghai Sangon Biotechnology Technology Service Co., Ltd), Maker (Thermo), RIPA Lysis Buffer (Beijing Kangwei Century Biological Technology Co., Ltd), Protease Inhibitor (Beijing Kangwei Century Biotechnology Co. Ltd), SDS-Page Loading Buffer (Beijing Kangwei Century Biotechnology Co., Ltd), SDS-PAGE Gel Preparation Kit (Beijing Kangwei Century Biotechnology Co., Ltd), ECL High Sensitivity Chemiluminescence Detection Kit (Beijing Kangwei Century Biotechnology Co., Ltd), ECL Low Background Luminescence Detection Kit (Beijing Kangwei Century Biotechnology Co., Ltd), One-step Rapid WB(HRP) Kit (Rabbit) (Beijing Kangwei Century Biotechnology Co., Ltd), One-step Rapid WB(HRP) Kit (Rat) (Beijing Kangwei Century Biotechnology Co., Ltd), IP3 (abcam), PLC (abcam), AT1R (abcam), AngII (NOVUS), β-actin (Jingtiancheng Biotechnology (Beijing) Co., Ltd), RNA preservation solution (Beijing Solaibao Biotechnology Co., Ltd), Animal Total RNA Lsolation Kit (Foregene Inc), RT EasyTM II( Foregene Inc), Real Time PCR EasyTM (Foregene Inc).
2.2 Animals and animal models
Male Sprague-Dawley (SD) rats (200-220g body weight) were provided by Changsha Tianqin Biotechnology Co., Ltd., animal license number: SCXK (Hunan) 2014-0011. All animal experiments were performed in accordance with the Animal Care and Use Committee of Guizhou University of Traditional Medicine.
Abdonminal aortic banding (AAC), which is the rat model of cardiac hypertrophy, was produced through the method reported by Anversa [21]. Anesthesia with 1% sodium pentobarbital (40mg/kg) intraperitoneal injection after animals fasting within 12 h, but water is allowed. iodine volts routine disinfection of abdominal skin then opens abdominal cavity to separate abdominal aorta carefully. 4-0 surgical suture through just below the abdominal aorta and hit slipknot standby, a 7-gauge needle with blunt tip was placed in parallel abdominal aorta, which was ligated with the abdominal aorta by the 4-0 surgical suture. In the sham group, this same procedure was performed but no abdominal aorta was ligated. Then the viscera was restored to its original position and the surgical incision was closed. All animals in the sham operation group and model group were given intramuscular injection of penicillin sodium (80,000 U /100g) for 3 consecutive days after operation. All rats were randomly divided into five groups: Sham group and Model group were given normal saline, the other groups were given corresponding doses of leonurine (30mg·kg-1 and 15mg·kg-1) and positive drug (losartan potassium tablet, 5mg·kg-1) by intragastric administration, once a day, a total of 28 days.
2.3 Hemodynamic detection method
The BL-420Ss was used to record and collect data. After dieting forbidden and water for free for 12 h, rats were anesthetized and fixed on the operating table. The right common carotid artery of rats was separated and the distal end of the common carotid artery was ligated with 4-0 surgical thread, the proximal end was clamped with artery clips. Then, insert the venous indwelling needle into the left ventricle. Record the left ventricular systolic pressure (LVSP), left ventricular end diastolic pressure (LVEDP), the rate of shrink/diastolic of left ventricular pressure (±)dp/dt max) after successful intubation for 15 min.
2.4 Determination of left ventricular hypertrophy index
After measuring hemodynamic parameters, blot the excess water on the surface of the heart with a filter paper and weight it then separates the Left ventricle (including ventricular septal) and calculate the (Heart weight index, HWI) and Left ventricular mass index (Left ventricular weight index, LVWI). According to the formulas:
HWI = whole heart weight(HW)/ body weight(BW),
LVMI = left ventricle weight(LVW)/ body weight(BW).
2.5 Hematoxylin and eosin (HE) staining
The left ventricular tissue was immobilized in formalin, then dehydrated with different concentration alcohol, embedded in paraffin, sectioned with a thickness of 5μm, dyed with HE. observed under the microscope and then calculated the Myocardial cell diameter.
2.6 Determination of Ca2 +, AngⅡand AT1R content
The left ventricular myocardial tissue was added to PBS(1:9 weight to volume ratio), grind on ice. Then, the homogenate was centrifuged for 8 minutes, finally drawing the supernatant to test.
Ca2+ determined by colorimetry, AngⅡ and AT1R determined by ELISA, detection step kit brochures to.
2.7 Real-time PCR analysis
Total RNA was extracted with Trizol. The concentration and purity of the extracted total RNA were determined by a micro nucleic acid analyzer. The cDNA was reverse-transcribed by PrimeScriptTM RT Reagent. Then the cDNA was amplified by Real time PCR using a real-time fluorescence quantitative PCR instrument. and the relative quantification was performed with internal reference as the standard. The mRNA relative expression levels of ANF, β-MHC, AngⅡ, AT1R, c-fos, c-myc in rat cardiac tissue were calculated by the 2-△△CT method. The PCR primer sequences for rat ANF, β-MHC, AngⅡ, AT1R, c-fos, c-myc and housekeeping gene β-actin were designed and synthesized by Shanghai Sangon Biotechnology Technology Service Co., Ltd. The primer sequences were shown in Table 1.
Table. 1 Primer sequences for real-time quantitative RT-PCR
Gene
|
Forward primer (5′-3′)
|
Reverse primer (5′-3′)
|
ANF
|
CCAGAGAGTGAGCCGAGACAGCAAAC
|
CTCCTCCAGGTGGTCTAGCAGGTTCT
|
β-MHC
|
GCGAGCTGGCTAGGCAACTGGAAGA
|
TGGCGTCCGTCTCATACTTGGTCCTC
|
c-fos
|
GTGGACCTGTCTGGTTCCTTCTATGC
|
CTCGTTGCTGCTGCTGCCCTTT
|
c-myc
|
CACCGCCTACATCCTGTCCGTTCAA
|
CGAGATTCCAGCTCCTCCTCACTTCC
|
AngII
|
GGCAAATCTGGGCAAGATGGGTGACA
|
TGGCGAACAGGAACGGACTGCTCAG
|
AT1R
|
CCAAGGCTGGCAGGCACAGTTACAT
|
ACACTGGCGTAGAGGTTGAAGCTCAC
|
β-actin
|
GAAGATCAAGATCATTGCTCCT
|
TACTCCTGCTTGCTGATCCA
|
2.8 Western blot analysis
The myocardial tissue of rats homogenizer homogenate cracking in low temperature, protein extraction kit was used to extract total protein, sample concentration with protein content detection kit determination method (BCA), with SDS denaturant, boil degeneration, after SDS-PAGE, using constant pressure turn wet method, 120 v, transfer film 2 h, the protein on the gel strips to PVDF membrane. The PVDF membrane was closed by slow shaking in 3%BSA solution at room temperature for 2 h, and then incubated overnight with AngⅡ, AT1R, PLC, IP3 total protein antibodies at 4℃, respectively. After washing with TBST 5 times, then incubate the secondary antibody for 1.5 h. After washing with TBST 5 times, use the ECL to chemiluminescent and use Imaging System to image.