Clinical specimens
Five pairs of snap-frozen GC tissues and matched adjacent normal mucosa tissues were obtained for lncRNA microarray analysis. Furthermore, two cohorts of frozen samples used for qRT-PCR assay were collected: a small GC cohort (Cohort 1) contained 18 pairs of GC tissues and corresponding adjacent normal mucosa tissues to confirm 13 lncRNAs with more than a 4-fold difference in microarray analysis; and a large GC cohort (Cohort 2) included 92 pairs of GC tissues and matched adjacent normal samples to detect the expression levels of SGO1-AS1, TGFB1/2 and ZEB1. Additionally, GC tissue microarrays containing 95 GC tissues and 80 adjacent tissues (Cohort 3) used for ISH analysis were enrolled for this study. All tissues were collected immediately after surgery from the Affiliated Cancer Hospital of Guangzhou Medical University (Guangzhou, Guangdong, China). The clinical and histopathological characteristics for the patients are described in Additional file 1: Table S1-2.
Microarray analysis
Total RNA was extracted from 5 paired GC tissues and corresponding adjacent normal mucosa tissues using the TRIZOL reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Total RNA was amplified and reverse-transcribed into fluorescent cDNA. The labeled cDNA was then hybridized onto the LncRNA + mRNA Human Gene Expression Microarray V4.0 (Agilent, Palo Alto, CA), and after washing, the arrays were scanned with an Agilent Scanner G2565CA (Agilent). Agilent Feature Extraction software (version 10.7.3.1) was used to analyze the acquired array images and the Agilent qRT-PCR results. Data are available via gene expression omnibus (GEO) under accession number GSE157289.
qRT-PCR
Total RNA was isolated from patient tissues and cultured cells using TRIzol reagent (Invitrogen) and cDNA was synthesized using the PrimeScript RT Reagent Kit (Takara, Otsu, Japan). Subsequent quantitative polymerase chain reaction (qPCR) analyses were performed using the SYBR Premix Ex Taq Kit (Applied Biosystems, Foster City, CA, USA). β-actin was used as the endogenous control to normalize gene expression. The primer sequences for each gene are provided in Additional file 1: Table S3.
In situ hybridization
ISH analysis was performed using a kit from Boster (Wuhan, Hubei, China). Tissue microarray slides were deparaffinized, digested with proteinase K, hybridized with DIG-labeled probes for SGO1-AS1 and U6 at 52℃ overnight and subsequently visualized with an anti-DIG-POD antibody and DAB complex. The SGO1-AS1 probe was 5’- CCGCCTCCCAGCCAACCAATGGAGGAGCGAGGCG-3’. We quantitatively scored the tissue sections based on the percentage of positively stained cells and staining intensity.
Rapid amplification of cDNA ends (RACE) analysis
We used the 5’-RACE and 3’-RACE analyses to determine the transcriptional initiation and termination sites of SGO1-AS1 using a SMARTer™ RACE cDNA Amplification Kit (Clontech, Palo Alto, CA, USA), following the manufacturer’s instructions. Nested PCR products were cloned into pMD20-T vector and then sequenced. The sequences of SGO1-AS1 specific primers used in nested PCR of RACE assay are shown in Additional file 1: Table S4.
Subcellular fractionation
Nuclear and cytoplasmic separation was performed using the PARIS Kit (Life Technologies, USA) according to the manufacturer’s instructions, and then qRT-PCR analysis was conducted.
Cell culture
The GC cell lines SGC7901, BGC823, AGS, MGC803, MKN45 and MKN28 were obtained from the Chinese Academy of Medical Science (Beijing, China), and the gastric epithelial cell line GES-1 were obtained from the Beijing Institute for Cancer Research (Beijing, China). The GC cell line NCI-N87 and the HEK293T cell line were obtained from the American Type Culture Collection (Manassas VA, USA). The cell lines involved in our experiments were reauthenticated by short tandem repeat analysis every 6 months after resuscitation in our laboratory. These cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco, USA) supplemented with 10% fetal bovine serum (Gibco) at 37℃ in 5% CO2.
RNAi, plasmid construction and cell transfection
The recombinant lentiviral vectors for SGO1-AS1 overexpression or knockdown were purchased from RiboBio (Guangzhou, Guangdong, China), and PTBP1 short hairpin RNA (shRNA) lentiviral vectors were obtained from GeneChem (Shanghai, China). The target sequences for SGO1-AS1 and PTBP1 were as follows: shAS1#1, 5’-GCTATCTTCCTCCTCCTCACA-3’; shAS1#2, 5’-CTACCGCCGCCACATTCGAAA-3’; shAS1#3, 5’-GCCTCCCTCTTGTGAGAAGAA-3’; shAS1#4, 5’-AGCTTGCAACGCGGAAGCAGC-3’; and shPTBP1, 5’-GCGGCCAGCC CATCTACATC-3’. To establish the cell lines that stably overexpress or deplete SGO1-AS1, SGC-7901 cells were infected with recombinant SGO1-AS1 lentiviruses, while MKN28 cells were infected with SGO1-AS1 shRNA lentiviruses. The infected cells were then selected with 1 mg/L puromycin (Invivogen, San Diego, CA, USA) for 2 weeks to obtain cells with stable overexpression or knockdown of SGO1-AS1. Two siRNAs targeting ZEB1 were designed and synthesized by Sangon Biotech (Shanghai, China), and their sequences are shown as follows: #1 sense, GGCAAGUGUUGGAGAAUAAUC, antisense, UUAUUCUCCAACACUUGCCUU; #2 sense, GGACAGCACAGUAAAUCUACA, antisense, UAGAUUUACUGUGCUGUCCUG. To construct the reporter vectors for SGO1-AS1 promoter activity, wild-type SGO1-AS1 promoter sequence (1kb of sequence upstream of the transcription start site) and its ZEB1-binding site mutated sequences were chemosynthesized in Huada (Shenzhen, Guangdong, China) and inserted into the vector pGL3 basic (Promega) upstream of the firefly luciferase gene.
PTBP1 knockout by CRISPR/Cas9
The small guide RNA (sgRNA) targeting the genome sequence of PTBP1 was cloned into LentiCRISPRv2 (Addgene), and lentivirus particles were generated by co-transfecting the recombinant vector and packaging plasmids into HEK293T packaging cells. MKN28 cells were infected with lentiviruses, and single cells were isolated 48 h after infection by FACS (BD FACS Aria III) into 96-well plates. Independent clones were allowed to grow for 3 weeks. PTBP1 knockout cells were identified by Western blotting and targeted Sanger sequencing. The sgRNA targeting PTBP1 was 5’-CAGAGCAGACCCGCGGGGGA-3’.
Western blotting analysis
Western blotting analysis was performed using the standard procedures. The following primary antibodies were used in the experiments: anti-PTBP1 antibody (Cell Signaling Technology, Beverly, MA, USA), anti-PTBP2 antibody (Abcam, Cambridge, UK), anti-PTBP3 antibody (Sigma-Aldrich, St. Louis, MO, USA), anti-HNRNPK antibody (Abcam), anti-HNRNPM antibody (Sigma-Aldrich), anti-FUBP3 antibody (Abcam), anti-CPSF2 antibody (Abcam), anti-G3BP2 antibody (Atlas Antibodies), anti-TGFβ1 antibody (Proteintech Group), anti-TGFβ2 antibody (Abcam), anti-p-SMAD2 antibody (Cell Signaling Technology), anti-SMAD2 antibody (Cell Signaling Technology), anti-p-SMAD3 antibody (Cell Signaling Technology), anti-SMAD3 antibody (Cell Signaling Technology), anti-SMAD5 antibody (Abcam), anti-ID2 antibody (Abcam), anti-ZEB1 antibody (Abcam), anti-SNAI antibody (Abcam), anti-E-cadherin antibody (Proteintech Group), anti-Vimentin antibody (Cell Signaling Technology), anti-N-cadherin antibody (Cell Signaling Technology) and anti-GAPDH antibody (Sigma-Aldrich). The blots were incubated with goat anti-rabbit or anti-mouse secondary antibody (Sigma-Aldrich) and visualized with a commercial ECL kit (Pierce, Rockford, IL).
RNA pull-down assay
RNA pull-down assays were carried out as previously described. Briefly, The SGO1-AS1 sequences were cloned into pMD20-T vector with T7 promoter and in vitro transcribed with biotin RNA labeling mix and T7 RNA polymerase (Invitrogen) according to the manufacturer’s instructions. The RNA pulldown assay was performed using the Pierce Magnetic RNA-Protein Pull-Down Kit (Millipore, Bedford, MA, USA) in accordance with the manufacturer’s instructions. Finally, the retrieved proteins were measured on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS PAGE) gels for mass spectrometry or Western blot analysis.
RNA immunoprecipitation (RIP) assay
RIP assay was performed using the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, Bedford, MA, USA) according to the manufacturer’s instructions. Briefly, 100 µL cell extract was incubated with magnetic beads-antibody complex. The antibodies were used for RIP, and IgG served as a negative control. The precipitated RNAs were isolated using Trizol (Invitrogen) for RNA sequencing (RNA-seq) or qRT-PCR analyses.
Chromatin immunoprecipitation (ChIP) assay
ChIP assay was performed using a Chromatin Immunoprecipitation Assay Kit (Millipore, Bedford, MA, USA). MKN28 cells were exposed to TGFβ1 or vehicle for 24 h, then crosslinked, lysed and sonicated. Immunoprecipitation was performed using anti-ZEB1 antibody (Abcam, Cambridge, UK) and IgG. The precipitated DNA was quantified using qPCR and normalized by respective 2% input.
RNA-seq analysis
To seek out differentially expressed genes upon PTBP1 knockout, total RNA was isolated from PTBP1 knockout or control MKN28 cells using TRIZOL reagent, and PolyA RNA was subsequently purified from total RNA using NEBNext Poly(A) mRNA Magnetic Isolation Module. RNA-seq was performed to detect the mRNA expression profiles at GENTED (Shanghai, China) using HiSeq3000 (Illumina, USA). The differential genes were selected with fold change > 2 and a P-value < 0.05. To reveal PTBP1-bound mRNAs, RIP experiments were conducted using a PTBP1 antibody (Cell Signaling Technology) or IgG. Total RNA was isolated with Trizol (Invitrogen), and ribosomal RNA was removed from total RNA. RNA-seq was performed at CLOUDSEQ (Shanghai, China) using HiSeq3000 (Illumina, USA). Data are available via GEO under accession numbers GSE157582 and GSE157941.
Luciferase reporter assay
HEK293T cells were seeded in 24-well plates and transfected with the SGO1-AS1 promoter reporter constructs with wild-type or mutated ZEB1 binding sites. The pTK-Cluc vector was used as the internal transfection control. The transfected cells were treated with TGFβ1 (5 ng/mL) or vehicle control for 48 h, and Firefly and Renilla luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega), following the manufacturer’s instructions. SBE4 promoter luciferase reporter vector (Addgene) was transfected into PTBP1 knockout or control MKN28 cells. In addition, HEK293T cells were transfected with SBE4 promoter reporter vectors and then treated with conditioned medium from cells with SGO1-AS1 knockdown or overexpression. Firefly and Renilla luciferase activities were measured 48 h after transfection using the dual luciferase system.
Cell invasion, migration and proliferation assays
For the cell invasion assay, starved cells suspended in serum-free DMEM were seeded into the upper chamber with Matrigel in the insert of a 24-well culture plate (Corning Costar). Medium containing 15% fetal bovine serum was added to the lower compartment as a chemoattractant. After incubation for 48 h, the invasive cells adhering to the lower membrane of the inserts were fixed, stained, counted and imaged. Cell migration ability was measured using the wound-healing assay. Cells were placed into 6-well plates and cultured until 90% confluence. An artificial scratch was created using a 10 µL pipette tip, and the cells were cultured in serum-free medium. Wound closure images were captured in the same field under magnification. Cell proliferation was examined using cell counting. Cells were seeded into 6-well plates, and the cell numbers were counted after 1, 2, 3, 4, 5, 6 and 7 days of culturing in DMEM supplemented with 10% fetal bovine serum using a Coulter Counter.
Sphere culture
Cells were seeded into ultra-low attachment 6-well plates (Corning Costar) and cultured in DMEM/F12 medium (Gibco) supplemented with 2% B27 (Life Technologies), 20 ng/ml FGF (R&D Systems, MN, USA), 20 ng/ml EGF (R&D Systems) and 5 µg/ml insulin (R&D Systems). Two weeks later, sphere pictures were taken and sphere formation ratios were calculated.
Animal experiments
Female 6- to 8-week-old BALB/c nude mice were purchased from the Experimental Animal Center of Guangdong (Foshan, Guangdong, China). To investigate the role of SGO1-AS1 in tumor metastasis and growth in vivo, luciferase-labeled SGC7901 cells overexpressing SGO1-AS1 or control vector were injected into the tail vein or stomach of the BALB/c nude mice. The luciferase signal intensity was monitored in vivo using an In Vivo Imaging System (FX PRO, Bruker, Billerica, MA, USA). Then, the mice were sacrificed, and the metastatic foci in the abdominal cavity and lung were evaluated. In addition, SGC7901 cells with SGO1-AS1 overexpression or control cells were subcutaneously injected into the nude mice. The mice were sacrificed after 28 days of implantation, and the tumors were excised and weighed.
To confirm the inhibitory effects of SGO1-AS1 on metastasis activity via TGFβ signaling in vivo, we orthotopically implanted luciferase-labeled MKN28 cells stably expressing shSGO1-AS1 or control shRNA into the stomach of nude mice and treated the mice with saline, SB431542 (20 mg/kg body weight, i.p) three times per week for 3 weeks. The luciferase signal intensity was monitored in vivo by bioluminescence imaging.
Statistical analysis
A Student’s t-test or a chi-square test was used for two-sample comparisons. Differences among three or more groups were analyzed with two-way analysis of variance. The overall survival curves were plotted using the Kaplan-Meier method, and survival differences were evaluated with a log-rank test. Cox regression was utilized to estimate the hazard ratio and 95% confidence intervals for survival. Pairwise expression correlation was analyzed using Pearson correlation tests. Values of P < 0.05 were considered as statistically significant.