Cell culture
Glioma cell lines were obtained from American Type Culture Collection (ATTC). DMEM cell culture medium (Gibco), including FBS (Gibco), penicillin, and streptomycin (100U/mL), was used for cell culture at 37oC with 5% CO2 in a humidified atmosphere. The U87Sc and U251Sc were isolated from U87 and U251 glioma cells by the method of serum clone formation. Medium without serum was composed of DMEM/F12 (Hyclone), 2% B27 supplement (Invitrogen), 20ug/L epidermal growth factor (EGF) (Sigma), 20ug/L basic alkaline fibroblast growth factor (bFGF) (Sigma). After 10 days, oncospheres were observed, dissociated, and passaged in a fresh medium.
Transfection
Lentivirus-mediated shRNA to knockdown LncRNA-RP5 and negative control lentiviral vectors were designed and synthesized by GenPharma (Suzhou, China). Lentivirus was packaged into HEK-293T cells and collected as per manufacturer’s instructions. U87 and U251 glioma cells were used for lentiviral particle infection, and stable cells were established using puromycin as a selection marker.
Real-Time quantitative PCR
Trizol reagent was used to extract RNA from glioma and GSCs cell lines, and stored at -80℃. RNA was transcribed into cDNA by using a reverse transcription kit (Vazyme, China). The qPCR experiment was carried out using the SYBER Prime Script RT-PCR kit (Takara) on ABI-7900 real-time PCR system. The Expression of gene was calculated using the 2−ΔΔCT method. The primer sequences were used as follows:
LncRNA-RP5-46C24.7
Forward: 5’ GTCTGAACATCACGCCGAACT 3’,
Reverse:5’ AGAACCCCTGGTATCAGTGCTAT 3’
GAPDH
Forward:5’GCACCGTCAAGGCTGAGAAC 3’,
Reverse:5’ TGGTGAAGACGCCAGTGGA 3’
Cell proliferation
Lentivirus-mediated sh-RP5 Stable cells (U87, U251, U87Sc, and U251Sc) and negative control cells were subjected to cell Counting Kit-8 (CCK8) (Biosharp, China) for proliferation study. In short, 3000 cells of each group were plated in 96 well plates, and cell viability was measured at 1-4 days. The OD (Optical Density) was detected at 450nm by a microplate reader (Perkin Elmer, USA).
Migration assay
Glioma cells migration was evaluated by using transwell chamber (Miltenyi) according to previously reported method[21]. Briefly, the equal number of cells suspended in medium (without serum), placed onto the upper chamber, and 0.6 mL of medium with FBS was added to the lower chamber. After the incubation of 24hrs, the glioma cells on the upper surface of chamber were removed, and methanol was used for 15min to fix the cell of the lower chamber. Then cells were stained with 1% crystal violate for a half hour and counted.
Oncosphere-formation assays
Ultra-low attachment 6-well plates were used to seed 5×103 GSCs cells/mL in modified DMEM medium, as defined in the cell culture section, without serum supplementation. The Medium of cells were changed every 72-96 hrs. GSCs were dissociated into single cells and grew in 24 well plates at a density of 200 cells/well. After 14 days of growth, the numbers and diameters were calculated.
Flow cytometry
Cell apoptosis was determined by the Annexin V-FITC apoptosis detection kit (Vazyme
Nanjing, China) following the manufacturer’s protocol. sh-RP5 cells and negative control cells were washed with PBS and then resuspended in staining buffer. The Annexin V-FITC and Propidium Iodide (PI) fluorescence levels were measured by flowcytometry (FCM).
Immunostaining
Four percent paraformaldehyde (PFA) was used to fix U87 and U251 sh-RP5 and NC cells at 4°C for 12hrs. Fixed cells were permebilized in PBS with 0.3% Triton X-100 at room temperature for 20min. 10% normal goat serum (NGS) in PBS with 0.3% Triton X-100 was used to block permeabilized cells for 2hrs at room temperature. The blocked cells were placed in primary antibodies diluted in PBS with 10% NGS and 0.3 triton X-100for 12hrs at 4°C. Then, cells were washed and incubated with secondary antibodies for 2hrs at room temperature. Mounting solution (Prolong ® Gold antifade reagent with DAPI) were used to mount the cells. Then, the slides were examined by using Fluoview (FV3000, Olympus) confocal microscope.
Western blotting
RIPA lysis buffer containing Protease inhibitor was used for protein extraction. The BCA kit was used to measure the protein concentration of samples. As per the previously reported method, western blotting experiments were analyzed [22]. Protein expression were detected by using the following antibodies: EpCAM (Abcam), CD44, SOX2, Nanog, N-cadherin E-cadherin, β-catenin, phospho-β-cateninSer33/37/Thr41, Non-phospho (Active) β-catenin Ser33/37/Thr41 (Active-β-- catenin) (Cell Signaling), c-Myc, CHOP (Proteintech), and Caspase-4 (Santa Cruz). Antibodies were diluted according to specification. The Chemiluminescence method was used for the examination of protein expression
Tumor mice model
The xenograft tumor mice model was generated by subcutaneously injected sh-RP5 (U87) and NC glioma cells. The sh-RP5 stable and NC (5×106) in 200µL media without serum were implanted into the lateral thoracic region of BALB/c athymic nude mice (female, aged three-four weeks and 18-20g weight) supplied by the KeyGENBioTECH corp., Ltd. Tumor volume was observed by measuring length and width every week. The tumor volume was calculated using the formula: volume = (length × width2)/2.
Statistical analysis
GraphPad Prism 5.0 (GraphPad Software Inc.) was used for statistical analysis. Data were expressed as the mean ± standard deviation (SD). P-values less than 0.05 were considered statistically significant.