Experimental Animals
C57BL/6 mice were purchased from Shanghai Genechem Animal Co. Ltd (NO. SYXK 2015-0008). The guide RNA (CX3CL1-sgRNA1: ctggcaggttatcacgggttggg and CX3CL1-sgRNA2: TGGCAGTAACTCATACGTCCTGG) were constructed using the CRISPR/Cas9 technique. Transgenic founder mice were generated by microinjection embryos, then mated to wild-type mice to obtain independent lines of FKN knockout (FKN-KO, FKN-/-) mice. All mice were kept in the specific pathogen-free (SPF) of the Youjiang Medical University for Nationalities (NO. SYXK 2017-0004). All procedures were performed according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved by the ethics committee of Youjiang Medical University for Nationalities.
8-10 weeks old WT and FKN-KO mice (n=5 each) were randomized into four groups: Control group: WT mice intraperitoneal (IP) injection of Saline, LPS group: WT mice IP injection of LPS (10mg/kg, 24h) (Sigma-Aldrich, St. Louis, MO, USA), FKN-KO group: FKN-KO mice IP injection of Saline, FKN-KO+LPS group: FKN-KO mice IP injection of LPS (10mg/kg, 24h). For survival test, mice were IP injected with LPS and monitored every 2 hours for 48 hours.
Cell Culture and Treatments
Immortalized mouse podocytes were obtained from the Cell Center of Fudan University (Shanghai, China). Podocytes were cultured in RPIM 1640 medium (Gibco, Australia) with 10% FBS (Gibco, Australia) and were maintained at 37°C, 5% CO2 incubator. Cells were divided into four group: Control group, Si-NC group: podocytes were transfected with siRNA against scramble control (siRNA-control) (Shanghai Genechem Co., Ltd.), FKN-KD group: podocytes were transfected with siRNA against FKN (siRNA-FKN) (Shanghai Genechem Co., Ltd.), FKN-KD+LY294002 (a PI3K/A Akt signal inhibitor) (Selleck Chemicals, USA): FKN-KD podocytes infected with LY294002 (20 μM/mL, 48 h)[14].
Analysis of Blood Urea Nitrogen (BUN) and creatinine (Scr) activities.
All mice serum were collected and centrifugated at 4000 rpm for 15 min. BUN and Scr levels were examined by using the commercial kits (Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions.
Histopathology
Kidney samples were fixed with formalin at 4℃ overnight. Kidney were embedded with paraffin and cut into 4-μM sections. Then hematoxylin and eosin (HE) staining were prepared and visualized under a light microscope (Olympus, Japan).
Immunofluorescence Staining
All samples were fixed with 4% paraformaldehyde for 30 min at room temperature. After being washed three times with PBS, samples were incubated with 0.1% Triton X-100 for 20 min and blocked with goat serum for 30 min. Then kidney sections were incubated with anti-nephrin and anti-Bax (Affinity Biosciences, OH, USA), and podocytes were incubated with anti-Bax, anti-p-Akt (Affinity Biosciences, OH, USA) at 4℃, overnight. Next, samples were incubated with FITC and Fluor594-conjugated secondary antibodies (Affinity Biosciences, OH, USA) for 1 h at room temperature. The nuclei were stained with DAPI (5 μg/mL, Solarbio, Beijing, China) for 10 min and imaged by a fluorescence microscope (Olympus, Japan).
Western Blot Assay
Kidney tissues and podocytes were lysed with RIPA buffer (Solarbio, Beijing, China). Protein concentration were measured by a BCA assay kit (Solarbio, Beijing, China). Proteins (50 μg) were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), transferred to the polyvinylidene fluoride (PVDF) membrane, and incubated with anti-FKN, anti-Bax, anti-Bcl-2 and anti-Cyt-c, anti-nephrin, anti-podocin, anti-Akt, anti-p-Akt, (Affinity Biosciences, OH, USA) overnight at 4℃. Then incubated with horseradish peroxidase-linked secondary antibody (Affinity Biosciences, OH, USA) for 50 min at room temperature. The protein expression was quantified using ImageJ.
Co-immunoprecipitation Analysis
Co-IP assay was conducted according to the manufacturer’s instruction of Co-IP kit (TK277274, Thermo Fisher Scientific). Briefly, Podocytes total protein was extracted by IP lysis buffer and quantified by BCA assay. The podocytes lysates were incubated with anti-FKN, anti-Akt, anti-p-Akt and protein A/G agarose beads at 4℃ overnight. Then the beads were washed with pre-cold IP lysis buffer and 50 μL of immunoprecipitated proteins were collected. the precipitated proteins were identified by Western blot assay.
Flow Cytometric Assay
After treatment, podocytes were adjusted to 1×106 cells/mL and stained with Annexin V-FITC and propidium iodide using Annexin V-FITC Apoptosis kit (BD Biosciences, USA). The apoptosis rate was measured by flow cytometry (BD Biosciences, USA).
Statistical Analysis
Statistical analysis was performed using SPSS 23.0 software. The data were expressed as mean ± standard deviation. The Student t test was used to determine the statistical difference between two groups. Differences between more than two groups were determined by ANOVA. P < 0.05 was considered statistically significant.