Animals
Animal management procedures were undertaken in accordance with the requirements of the Institutional Animal Care and Use Committee (IACUC), Menoufia University, Egypt. The protocol of this study has been approved by the ethics review board of the IACUC of Faculty of Science (ID: MUFS-F-EC-1-20). The experiments in this study were in compliance with the ARRIVE guidelines.
Juveniles of O. niloticus (30.4 ± 9.3 g, 11.9 ± 1.3 cm) were supplied by the Fish Hatchery Station of Kafer-elsheikh Governorate, Egypt. Fish were acclimatized for 14 days in dechlorinated tap water aquaria (50 L). The constant aeration was performed using electric air pumps. Water conditions were constant at 21.35 ± 0.81°C temperature, 6.5 ± 0.55 pH, 276 ± 0.39 µS cm− 1 conductivity, 0.04 ± 0.03 of ammonia concentration. The commercial fish diet containing 25% protein (Tag-elmlook Company, Baltim, Kafer-Elsheikh) was used in feeding. Feeding was suspended 48 h prior to the start of the experiment and during the experiments.
Chemicals
-
Imidacloprid (Imid), [1-(6-chloropyridin-3-ylmethyl)-N- nitroimidazolidin-2-/ylideneamine]. It was purchased in a commercial form (CLAS 35% SC, CAS. 1811, PHARMA CURE, Wady Alntron, Egypt).
-
Ascorbic acid (C6H8O6, M.W. 176.13, assay 99%, S.D. Fine-Chem. Ltd., K07Z0907/1710/62, Mumbai, India)
Experimental design, dosing and sampling
The lethal concentration 50 (LC50) of Imid to Nile tilapia juveniles was determined (72h-LC50) in this study according to Yuniari et al. 69. The study was carried out using two doses of Imid sub-lethal concentration (1/10 & 1/20 of LC50) and a concentration of 50 ppm for Asc as described by Ghazanfar et al. 33. Fish were randomly divided into six groups (n = 10 fish per group, five of them were processed for chromosomal preparation and the remained five fish were used for other investigations). Fish were maintained in glass aquaria containing dechlorinated tap water (50 L). Frist group was used as control and the second group was exposed to Asc only. Other two groups were subjected to Imid concentrations of 17.5 ppm (1/10 of LC50) and 8.75 ppm (1/20 of LC50). Finally, two co-treatment groups were exposed to Imid and Asc (17.5 ppm -Imid + 50 ppm Asc) and (8.75 ppm-Imid + 50 ppm Asc). The experiment was performed for 21 days according to Al-Anazi et al. 27,33, under static conditions. Water renewal (30%) was done daily to overcome the daily degradation of Imid and Asc as previously described 33,70 and in agreement with the HPLC results.. Further, all aquaria were laterally covered with black sheets to minimize the effect of light on Imid and Asc, where, Asc is light sensitive 71. During the experiments, temperature measurements, dissolved oxygen, ammonia levels, pH and water conductivity were adjusted as acclimatization conditions.
After the exposure period, caudal vein puncture was used to collect blood samples and processed for MN test and comet assay. After blood sampling fish were sacrificed on ice immediately by medullar sectioning for liver removal. Organs were quickly stored in -20 ºC for gene expression and biochemical analyses. In addition, samples of liver and gills were freshly processed for comet assay.
For biochemical analyses, samples of liver tissues were homogenized (1:10 wt./v) in a 0.1M phosphate buffer solution (pH 7.1 containing 1mM Mercaptoethanol and 2mM EDTA). Samples were centrifuged (15,000 xg, 20 min, 4 ºC) and the supernatants were stored at -80 ºC for subsequent biochemical analyses. For all biochemical biomarkers assessment, the determination of liver protein content was done 72. Experiments were done in triplicates.
Assessment of Imid and Asc degradation in water
HPLC quantification of Imid and Asc in water samples was done using High performance liquid chromatography (HPLC) analysis. After 24h of exposure period, water samples were collected in clean amber glass bottles and HPLC analysis was performed. The ZORBAX Eclipsed XDB-C18 column (4.6x 150 mm, 5um) and Zorbax C8 column (4.6 mm x 150 mm i.d., 5 µm) were used for chromatographic separation of Imid and Asc, respectively. The mobile phase consisted of methanol: water (60: 40%, respectively) for Imid and 0.01% trifluoroacetic acid in water and methanol (70: 30%, respectively) for Asc. Identification and quantification of Imid was performed by HPLC-DAD using an Agilent 1260 device (Agilent Technologies, CA, USA).
Biochemical analyses
The homogenized liver supernatants were used to determine the lipid peroxidation as malondialdehyde (MDA) levels 73. Results were presented in nmol/mg protein. The activities of superoxide dismutase (SOD) 74, catalase (CAT) 75, and glutathione peroxidase (GPX) 76 were determined colorimetrically and presented as U/mg protein. The analyses were done using colorimetric Bio-Diagnostics kits (Bio-Diagnostics Co, Giza, Egypt) according to the manufacturer’s instructions (CAT. No. MDA, MD 2529; SOD, SD 2521; CAT, CA 2517 & GPX, Gp 2524).
Gene expression
Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out to evaluate the expression of liver SOD, CAT and GPX genes in tilapias. Used primer sequences were illustrated in Table (1). The total RNA was extracted from tissue using the RNeasy Kit (Qiagen, Hilden, Germany) following the company's protocol. The Reverse Transcript kit (Qiagen, Hilden, Germany) was used cDNA synthesis. The qPCR of the β actin (a housekeeping gene) and studied genes were performed using a Qiagen QuantiTect SYBR Green PCR kit in a Rotor-Gene Q cycler (Qiagen, Hilden, Germany).
Table 1
Sequences of used primers.
Primer
|
Primer Sequence (5’→3’)
|
Accession number
|
Reference
|
SOD
|
F:GGTGCCCTGGAGCCCTA
|
JF801727.1
|
43
|
R: ATGCGAAGTCTTCCACTGTC
|
|
CAT
|
F: TCCTGAATGAGGAGGAGCGA
|
JF801726.1
|
43
|
R: ATCTTAGATGAGGCGGTGATG
|
|
GPX
|
F: CCAAGAGAACTGCAAGAGA
|
FF280316.1
|
43
|
R: CAGGACACGTCATTCCTACAC
|
|
β-actin
|
F: CAATGAGAGGTTCCGTTGC
|
EF206801
|
77
|
R: AGGATTCCATACCAAGGAAGG
|
|
Genotoxic analysis
Single cell gel electrophorese of erythrocytes, gills and liver cells was performed according to Singh et al. 78. Briefly, the tissues of tested organs were cut into small pieces and homogenized gently in a phosphate buffer (1:10 wt. /v). The homogenate was meshed to obtain a cell suspension then centrifuged at 200 xg for 5 min to obtain the pellet of individual cells. On glass slides precoated with normal (1%) melting point agarose, cells of tested organs were suspended in low melting point agarose (0.5%) between two layers of ultra-pure normal melting agarose (0.7%). The slides were subjected to: a) lysis: 2 h at 4 oC, in dark, in lysis buffer (2.5M NaCl, 100mM EDTA, 10mM Tris, 1% sodium lauroyl sarcosinate, 10% DMSO, 1mL Triton X-100, pH 10.0); b) DNA denaturation: in an electrophoresis buffer (0.3 N NaOH,1mMEDTA, pH > 13, at 4 oC) for 30 min in the dark; c) electrophoresis: 20 min, 300mA, 25 V, 0.7e0.8 V cm-1; and d) neutralization: three rinses for 5 min each with neutralizing buffer (0.4M Tris, pH 7.5). For visualization of DNA damage, staining was done using 20 µg/mL of ethidium bromide. At 400 x magnification of at least 500 nuclei, the observation was done using a fluorescent microscope (Olympus BX41, Tokyo, Japan). The DNA damage was quantified by the appearance of the migrated tail and classified into two comet classes (normal and damaged).
Erythrocytic micronuclei (MN) and nuclear abnormalities (ENA) were investigated in fish groups after various treatments. In brief, O. niloticus blood samples smeared on glass slides. After air dryness, cells were fixed in absolute methanol for 15 min and stained with hematoxylin and eosin stain for 20 min each. The mean frequency of MN and NA per group was determined by the analysis of 1000 cells per fish (%). Kidney-shaped, lobulated, segmented nuclei, and binucleated cells were considered as nuclear abnormalities.
Chromosomal preparation was performed from tilapia Kidneys and the mitotic index was calculated 79,80. Briefly, a volume of 1 mL / 100 g b.wt. of colchicine (0.05%) was injected into the abdominal cavity of fish two hours prior to the dissection. After the kidney removal, it was cut into small pieces before mixing with 5 mL of the hypotonic solution (0.075M KCl). All large pieces of the kidney tissues were discarded. At room temperature, the suspended cells was incubated for 20 minutes, and centrifuged for 5 min at 400 g. Dropwisely, cells were applied to the fixation step using 5 mL of fresh cold fixative (3 methanol: 1 acetic acid) before centrifugation. The fixation process was repeated until the supernatant was cleared. A concentrated volume of each tube was dropped 15 cm high on a clean and 70% cold ethanol-dipped glass slide and left to dry at room temperature. The slide was conventionally stained for 30 minutes with 20% Giemsa solution, pH 6.8. Metaphases and prophases were evaluated over 1000 nuclei per slide to calculate the mitotic index.
Statistical analysis
After data normality checking (Shapiro Wilk test) and homoscedasticity (Levene's test) mean values of all groups were cross-compared using parametric (ANOVA) by multiple comparison post hoc test, Dunnett's test. Also, the significance between Insecticide-treated group and the corresponding co-treatment group was compared by independent t test. The data shown in the graphs were represented as means ± SD. The significant level of differences was considered at P < 0.05. Statistical analyses were done using the IBM SPSS software version 21.1 (New York, NY, USA).