Animals
Animals used in this study were male WT mice of C57Bl/6 strain. GC-C and UGN KO mice that were generated (C57Bl/6 background) as described previously [10, 39]. GC-C and UGN KO mice were generously donated by Kris A. Steinbrecher, PhD and prof Anjaparavanda P Naren, PhD (Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio, USA). Before experiments were performed animals were maintained for several generations in our animal facility. Experiments were carried on 4–6 months old male mice and primary astrocyte cultures were isolated from new-borns (postnatal day 0) of WT animals.
We minimized animal suffering and reduced the number of animals used by using WT and GC-C KO littermates only when necessary. Mice were fed with standard rodent chow and had water and food ad libitum with day/night cycles of 12 h at 23OC and humidity between 50–75%.
WT and GC-C KO mice were anaesthetized with intraperitoneal injections of 2, 2, 2 – Tribromoethanol (250 mg/kg, Sigma-Aldrich, St. Luis, MO, USA) (IACUC Guidelines: Anaesthesia) and transcardially perfused with oxygenated (95% O2/5% CO2) ice-cold N-Methyl-D-Glucamine (NMDG) aCSF containing: 93 mM NMDG, 93 mM HCl, 2.5 mM KCl, 1.2 mM NaH2PO4, 30 mM NaHCO3, 20 mM HEPES, 10 mM MgSO4, 0.5 mM CaCl2 and 25 mM glucose, as described previously [40]. The brain was quickly isolated and cut slices for electrophysiological and Ca2+ measurements.
Primary astrocyte culture isolation by magnetic activated cell separation
WT mice pups (postnatal day 0) were anaesthetized on ice which is consider an IACUC Standard Procedure and decapitated when animal skin becomes light blue. Brains were carefully removed, meninges were stripped off, and brains were placed in StemPro® Accutase® (Thermo Fisher Scientific, Waltham, MA, USA) enzyme solution for 60 min on room temperature (RT). The enzyme reaction was stopped with the same volume of Dulbecco's Modified Eagle's Medium/F12 (DMEM/F12) (Thermo Fisher Scientific). Supernatant-containing cells were collected and centrifuged for 6 min at 300 g. Supernatant solution was removed and a cell pellet was subjected to magnetic activated cell separation (MACS) as described previously [41].
The cell pellet was incubated with Anti-Glast-biotin (Milteny Biotec, Bergisch Gladbach, Germany) antibody in 0.01 M phosphate buffer saline (PBS) containing 0.5% bovine serum albumin (BSA) for 15 min at + 4 oC. Cells were washed with PBS/0.5% BSA, centrifuged 10 min on 300 g and incubated with anti-biotin Microbeads antibody (Milteny Biotec) in PBS/0.5% BSA for 15 min at + 4 oC. Cells were then washed with PBS/0.5% BSA, centrifuged for 10 min at 300 g, a supernatant was removed, and cells were re-suspended in PBS/0.5% BSA. Columns for MACS were prepared and placed in a strong magnetic field (Milteny Biotec). The cell suspension was passed through the MACS column where astrocytes, tagged with anti-Glast/biotin/microbeads, were bound to column due to the magnetic field. The column was washed with PBS/0.5% BSA 3 times. Finally, the column was removed from the strong magnetic field and the remaining cells, which comprise 99% of astrocytes, were collected and plated on coverslips. Astrocytes were cultured in DMEM/F12 with an addition of 10% Foetal Calf Serum, 100 U/mL penicillin, and 100 µg/mL streptomycin, and maintained in an atmosphere of 5% CO2/95% air at 37 °C. Cells were used 3–10 (6.9 ± 0.5, mean ± SEM, n = 12) 6 days after isolation. For RNA isolation, astrocytes were re-suspended in TRI Reagent® Solution (Thermo Fisher Scientific).
RT-PCR
Total RNA was isolated from primary astrocytes, brain regions, and intestines of WT mice by TRI Reagent® Solution (Thermo Fisher Scientific). Mice were sacrificed by cervical dislocation followed by isolation of brain and intestine. Cerebral cortex, cerebellum, hypothalamus, and midbrain were carefully dissected from the brain. Total RNA (1 µg) from cells or tissues was used for cDNA synthesis (GoScript Reverse Transcription System (Promega, Madison, WI, USA)). PCR was performed using cDNA (1 µL) and the following primer sets: GC-C S: 5' TGCGCTGCTGGTGTTGTGG 3', AS: 5' CCCGAGGCCTGTCTTTTCTGTAA 3' (product size 341 bp); GAPDH S: 5' ACGGCCGCATCTTCTTGTG 3'; AS: 5' CCCATTCTCGGCCTTGACTG 3' (product size 235 bp), in the following conditions: 2 min at 94 °C, 30 s at 58.8 °C, 1 min at 72 °C (1 cycle); 30 s at 94 °C, 30 s at 58.8 °C, 1 min at 72 °C (30 cycles). The primer set for GC-C was designed to give equal product size for both GC-C isoforms. PCR products were analysed by agarose gel electrophoresis. GAPDH expression was used as cDNA control and a negative control was without cDNA in the reaction mixture. PCR products were verified by sequencing.
Immunohistochemistry
WT and GC-C KO mice were anaesthetized as described above and transcardially perfused with PBS and 4% paraformaldehyde (PFA). Brains were isolated and put in 4% PFA for 24 h and cryoprotected in 20% and 30% sucrose in PBS. 4 µm slices were cut on cryostat Leica CM3000.
After rehydration in PBS and antigen retrieval (5 min in boiling 10 mM Citrate buffer, pH = 6), permeabilization in 0.2% Tween-20 in PBS for 8 min was performed. Sections were blocked 1 h at RT with 1% BSA in PBS and incubated with primary antibody against GC-C (1:25, Santa Cruz, Santa Cruz, USA, sc-34428) at + 4 oC. After 3 washes with PBS, sections were incubated in secondary antibody (1:500, Alexa fluor 488, Thermo Fisher Scientific) for 1 h at RT. After washing, sections were incubated overnight with another primary antibody, anti-NeuN (1:1000, Abcam plc., Cambridge, UK, ab104225) or anti-GFAP (1:1000, DAKO, Agilent Technologies, Santa Clara, CA, USA, Z 0334) at + 4 oC. After 3 washes for 10 min in PBS, sections were incubated with secondary antibody (1:200, Cy5, Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA, code: 711-175-152) for 1 h at RT. After washing, sections were mounted by fluorescent mounting medium (DAKO).
Fluorescent signals were acquired by Zeiss LSM 510-META confocal microscope. Alexa flour 488 was excited by 488 nm argon laser line and fluorescent emission was collected from 505–530 nm. Cy5 labelling NeuN or GFAP was excited by 633 nm HeNe laser line and fluorescent signal was collected from 650–680 nm.
Electrophysiology
Coverslips with astrocytes were placed in the recording chamber and perfused with artificial cerebrospinal fluid (aCSF) without HCO3− (aCSF – HCO3− free) containing: 154 mM NaCl, 1.25 mM NaH2PO4, 2 mM MgCl2, 3 mM KCl, 2 mM CaCl2 and 10 mM glucose. Patch pipettes (5–7 MΩ) were filled with an internal solution containing: 115 mM K-gluconate, 20 mM KCl, 1.5 mM MgCl2, 10 mM phosphocreatine, 10 mM HEPES, 2 mM Mg-ATP and 0.5 mM GTP. Freshly made Nystatin (160 µM) was added to the internal solution to permeabilize cell membrane. The starting resistance of prepared pipettes was 5.3 ± 0.3 MΩ, n = 4, mean ± SEM and the liquid junction potential was compensated before the establishment of the cell-attached mode in all recordings. Cells were visualized under upright microscope Axioskop 2 FS plus (Zeiss, Oberkochen, Germany) and membrane potentials were recorded in perforated whole-cell configuration by SEC 0.5LX npi (npi electronic GmbH, Tamm, Germany) amplifier and WinEDR software (University of Strathclyde, Glasgow, UK).
For electrophysiological and Ca2+ measurements on brain slices, WT and GC-C KO mice were anaesthetized as described above and transcardially perfused with oxygenated (95% O2/5% CO2) ice-cold N-Methyl-D-Glucamine (NMDG) aCSF. The brain was quickly isolated and cut in 300 µm thick slices (Vibratome 1000 plus, The Vibratome Company, St. Louis, MO, SAD) in ice-cold NMDG-aCSF. Initial recovery was done in the same solution at 32 oC for 10 min followed by additional recovery for at least 60 min at RT in oxygenated aCSF: 128 mM NaCl, 1.25 mM NaH2PO4, 26 mM NaHCO3, 2 mM MgSO4, 3 mM KCl, 2 mM CaCl2, and 10 mM glucose before use.
Cerebellar slices of WT and GC-C KO mice were placed in the recording chamber and perfused (2–3 mL/min at 33 ± 1 OC) with oxygenized aCSF: 127 mM NaCl, 10 mM D-glucose, 1.25 mM NaH2PO4, 26 mM NaHCO3, 1 mM MgCl2, 3 mM KCl and 2 mM CaCl2. Purkinje cells were identified as large cells between the granular and molecular layers of cerebellar cortex under DIC. We used the same internal solution as described before; the size of patch clamp pipette was 6.0 ± 0.6 MΩ, n = 13, mean ± SEM. After establishing a seal, the cell membrane was mechanically ruptured.
Ca2+ Imaging
Astrocytes were incubated with 10 µM Fluo-4 AM in Hanks' Balanced Salt Solution (HBSS) (Sigma-Aldrich) on 37 oC in 5% CO2/95% air for 15 min and washed with HBSS before imaging.
Brain slices were loaded with 0.5 µM of SR101 (when applied) and 10 µM of Fluo-4 AM dye (Thermo Fisher Scientific) [42] or Oregon Green 488 BAPTA-1 AM (Thermo Fisher Scientific) in oxygenated aCSF containing 100 mM of mannitol for 20 min and recovered for 10 min in oxygenated aCSF at RT. Between two and three brain slices for each imaged region per animal were used.
The imaging was done using a Zeiss LSM 510 META confocal microscope. Slices or cells on coverslips were placed in the recording chamber and excited using 488 nm argon laser line and fluorescent emission was collected above 520 nm. The SR101 was excited using 543 nm HeNe laser line and fluorescent emission was collected above 560 nm. Acquired rate was 1 Hz. Analysis of fluorescent signal intensity was performed in MATLAB (MathWorks, Natick, MA, USA) and presented as ΔF/F0. The Ca2+ response in astrocytes were determine by measuring only the SR101 positive cells.
pH measurements
Astrocytes on coverslips were loaded with 10 µM BCECF, AM (Thermo Fisher Scientific) in HBSS for 15 min in 5% CO2/95% air at 37 °C and washed before imaging. Coverslips were put in the recording chamber and placed on inverted microscope Axiovert 10 (Zeiss). Cells were excited with two fluorescent wavelengths at 436 and 488 nm and emissions were detected at 520–560 nm with a single-photon-counting tube (H3460-04; Hamamatsu, Herrsching, Germany). Results were collected, analysed by Biofluor software, and presented as fluorescence ratio 488/436 nm.
An activity of NHE was tested by ammonia pulse [43]. Cells mounted on the recording chamber were perfused with aCSF – HCO3− free. After initial recording, 20 mM NH4Cl was added. During an ammonia pulse, NH3 enter the cells and binds H+ ions leading to alkalization. After removal, NH3 cells acidify and Na+/H+ exchanger returns pH to normal values by H+ transport (schematic representation Fig. 7a).
HCO3− transport was tested after initial perfusion of cells with aCSF – HCO3− free followed by perfusion with saturated aCSF (containing 26 mM NaHCO3) with 5% CO2/95% O2. Cell alkalinisation occurred due to HCO3− transport.
Behaviour tests
Hanging Wire Test was performed as previously described [44]. Animals grabbed the middle of 38 cm long and the 2 mm thick wire fixed at the height of 49 cm. The latency until animal fell down was recorded. The maximum of 30 s was used and the following points were assigned: 1–5 s one point; 6–10 s two points; 11–20 s three points; 21–30 s four points; more than 30 s or when mice reached the end of wire five points. If the recorded time was less than 5 s which could happen when animals did not hold on the wire properly, the experiment was repeated 3 times to get a better score. For all animals which scored 5 points at 2 mm wire (easy), the experiment was repeated using 4 mm wire (intermediate). Again, animals scored maximal 5 pints continued with the experiment using 6 mm wire (hard). All points were finally added. The maximal score was 15.
Rota-rod test was performed using Rota-Rod Model57604 with a rod of 3 cm diameter (Ugo Basile SRL, Gemonio, Italy) [45]. After the training period of 30 s at 5 rpm, the rod was accelerated from 5 to 40 rpm over 5 min. The endpoint was defined as the time when a mouse fell from the rod or was not able to walk on rotating rod. The first experiment was test one, which was followed by 3 trials in two consecutive days with the resting time for at least 6 h.
Statistical Analyses
For electrophysiological, Ca2+, and pH experiments as minimally required three animals per group were measured. For behaviour test, six animals per group were measured as previously shown [46]. The data are presented as median and interquartile range (IQR) or mean ± standard error of the mean (SEM). For statistical analyses Student’s t-test was used, where each effect was compared with its own control. If more than two parameters were compared we used ANOVA with post-hoc Tukey test. Statistical analysis for hanging wire behaviour test was done by Kruskal-Walls test with post-hoc Dunn test. A p value 0.05 was considered significant and is indicated by an asterisk. For statistical analyses, the GraphPad Instat (GraphPad Software, San Diego, CA, USA) statistical software was used.