GsLTP, a Non-Specific Lipid Transfer Protein from Glycine soja, Enhances Drought and Salt Stress Tolerance in Transgenic Tobacco

doi:10.21203/rs.3.rs-52965/v1

Download PDF

Research article

GsLTP, a Non-Specific Lipid Transfer Protein from Glycine soja, Enhances Drought and Salt Stress Tolerance in Transgenic Tobacco

https://doi.org/10.21203/rs.3.rs-52965/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Background

Lipid transfer proteins (LTPs) mainly exist in plant cell walls where they make an important impact in the transport of diverse lipophilic compounds. Although the functions of several LTPS in different plant species have been identified, little is known about the biochemical and enzymatic activities of LTP family members in soybeans.

Results

Herein, GsLTP was identified from Glycine soja using soybean gene microarray expression and screened in a salt stress expressed sequence tag (EST) library. The 369 bp open reading frame (ORF) encodes a protein of 122 amino acids, and the cDNA sequence shares similarity with LTP genes in other plants such as soybean (93%) and Vigna (72%). The function of the gene was characterized in transgenic tobacco. Various physiological characteristics under different environmental stresses were investigated. We discovered that over-expression of GsLTP enhanced tolerance to drought and salt stresses.

Conclusions

Our results indicate that GsLTP plays an important role in multiple abiotic signalling pathways, and provide a theoretical basis and practical gene resource for crop breeding.

Biotechnology and Bioengineering

Functional analysis

gene cloning

Glycine soja

lipid transfer protein

Southern blotting

RT-PCR

crop breeding

Abiotic stresses, including low temperature, drought and salinity, can cause a significant reduction in crop yield and quality[1]. Therefore, improving resistance to such adverse environments is extremely important for agriculture. New genes associated with stress resistance have been identified, and transgenic plants carrying these genes exhibit greater tolerance to drought stress[2], salt stress[3], cold stress[4], heavy metals[5], paraquat and wounding stress [1].

Non-specific lipid transfer proteins (nsLTPs) are widely present in the plant kingdom and are involved in the binding and transport of various lipids. All known plant nsLTP precursors include anN-terminal signal peptide, indicating that nsLTPs are secreted[6]. Mature nsLTPs are small proteins characterized by an eight-cysteine motif (8CM) with the consensus sequence C-Xn-C-Xn-CC-Xn-CXC-Xn-C-Xn-C[7, 8]. The eight cysteines are part of the four disulfide bonds that stabilize the three-dimensional structure of the hydrophobic cavity. This allows different lipids and hydrophobic compounds to bind[8–10]. Based on sequence similarity, ten types nsLTPs are divided from Arabidopsis, rice, Solanaceae and other plants [11].

Lipids play an important role in stress tolerance by mediating plant responses to environmental stimuli and cell signal transduction pathways, resulting in changes in energy storage and maintaining basic cellular functions. In these processes, lipid transformation proteins (LTPs) act as lipid transporters. Non-specific lipid transfer proteins (nsLTPs) can bind or transfer various hydrophobic molecules in vitro, such as fatty acids, fatty acyl coenzyme A, phospholipids, glycolipids and cutin monomers[6]. GsLTP belongs to the nsLTP family members of which playing important roles in numerous physiological processes, such as cutin and wax biosynthesis, abiotic and biotic stresses, seed development and germination, sexual reproduction, cell wall growth, nodulation, calmodulin (CaM) binding and responses to plant allergens[9, 12, 13].

Functions of LTPs under multiple abiotic stresses have been studied in various plants including Saccharum hybrid complex[14], Triticum turgidum[15],Solarium tuberosum[16] and Setaria italica[17]. NsLTPs from sugarcane respond to abiotic stresses and the signalling molecules salicyclic acid and methyl jasmonate[14]. The wheat proteinTdLTP4promotes tolerance to abiotic and biotic stresses in Arabidopsis thaliana[15]. Transgenic potato lines overexpressing StnsLTP1 display enhanced cell membrane integrity under stress[16]. SiLTP enhances salt and drought stress tolerance in foxtail millet, and may be partially upregulated by SiARDP[17]. Overexpression of a pepper nsLTP gene (CALTP1) in transgenic Arabidopsis increased the resistance of Arabidopsis against infection by Pseudomonas syringae pv. tomato and Botrytis cinerea. The tolerance of Arabidopsis to NaCl and drought stress at all stages of vegetative growth was improved [18].

Plant nsLTPs are involved in a varity of physiological functions, such as sebum transport, cutin synthesis, cell wall extension, pollen development, pollen tube growth and guidance, stigma and pollen adhesion, plant signalling, biological stresses, abiotic stresses and seed maturation[15, 19, 20]. Evidence suggests that nsLTPs are expressed in a wide range of plant cells, and they are involved in various physiological and biochemical processes, including cuticle synthesis and embryo development, adaption to a variety of stress environments, and resistance to microorganisms. However, the exact biological functions of these proteins have not been elucidated. At low temperatures, and under drought and NaCl treatment, high expression of nsLTPs has been detected in plant stems of tomato[21], barley[22] and sunflower[23]. These results indicate that nsLTPs help plants to adapt to adverse environmental conditions.

Glycine soja (Glycine soja Sieb. et Zucc), grown widely in Jilin Province in Northeast China, has a high tolerance to environmental challenges[24].It is a model species for molecular mechanisms of low temperature and salt stresses. The ancestor of cultivated soybean is a highly adaptable plant species that grows well in desert conditions[8, 25, 26]. It is also an excellent genetic germplasm for mining abiotic resistance genes for agricultural crop breeding[27]. In one of our earlier studies in which Glycine soja was grown under 150 mM NaCl and salinity responsive ESTs were identified. The expression of GsLTP was found to be induced to high salinity condition. In this study, we investigated the functions of GsLTP under salt or osmotic stress treatment. Our results showed that GsLTP enhanced the salt tolerance and drought resistance of plants by regulating the synthesis of protective compounds. Thus, this study enhanced our understanding of the functions of LTP genes and the mechanisms by which plants tolerate multiple stresses. Moreover, it provides theoretical basis and practical genetic resources for crop breeding.

Isolation of full-length GsLTP

In order to obtain the full-length GsLTP gene sequence, the original EST was identified and effectively extended from 254 to 689 bp by Phrap software. The extended sequence was analyzed by the NCBI BLASTx program. The extended GsLTP gene shares high similarity with genes in the LTP family, indicating its association with fatty acid transport in soybean.

Characterisation of GsLTP gene and protein sequences

After sequencing, multiple sequence alignment was performed with known LTP sequences. This comparison revealed high homology and the expected splice sites without nucleotide mutations. BLASTx analysis revealed that GsLTP is 369 bp in length and encodes a predicted polypeptide of 122 amino acids. The molecular weight of the protein is ~ 13 kDa and the predicted isoelectric point (pI) is 8.74. Amino acid sequence analysis with the NCBI BLASTp program revealed similarity with LTP proteins in a variety of plants, further indicating membership of the LTP gene family. The gene was therefore named GsLTP and submitted to GenBank (accession number FJ825765) after confirming its sequence.

Identification of transgenic tobacco lines

In order to identify transgenic tobacco lines, total DNA was isolated and the inserted fragment was verified by PCR (Fig. 1). The pBI121-GsLTP construct was successfully transferred into tobacco line #1, #3, #5, #6, #8, #10, #11, #12, #14, #15, #16, #17, #18, #19, #20, #21, #23, #24, #25, #26, #27 and #28. Total DNA was isolated from positive seedlings and digested with BamHI for Southern blotting (Fig. 2) and RT-PCR (Fig. 3). Southern blot hybridization results showed that three transgenic tobacco lines yielded positive electrophoretic bands (lanes 4, 5 and 7), indicating that the GsLTP gene was successfully transferred into the plant genome. Conversely, tobacco lines without a hybridisation signal indicated no gene integration. The signal in lanes 4 and 7 implied single copy insertion into the genome. However, lane 5 has two hybridisation bands, indicating insertion of two gene copies. As expected, the positive control (PCR product of pBI-GsLTP plasmid) displayed one band, validating the appropriateness of the experimental procedure (Fig. 2). RT-PCR was also used to investigate gene transcription in plants. The successfully amplified fragments in lanes 3, 6, 8, 10, 12, 14 and 16 confirmed these independent lines harbour the target gene (Fig. 3). After reliable identification, two transgenic lines (#85 and #96) were chosen for further functional analysis.

Overexpression of GsLTP enhances drought and salt stress tolerance in transgenic tobacco but not improves low temperature resistance

The results in Tables 1 and 2 reveal no significant difference between transgenic plants and non-transgenic plants regarding chlorophyll content under low temperature treatment (p = 0.2248, a = 0.05). However, significant differences in chlorophyll content were observed under drought (p = 0.0077, a = 0.05) and salinity (p = 0.0101, a = 0.05) treatments. Also, the chlorophyll content of transgenic seedlings was significantly higher than that of control seedlings under drought treatment. We therefore concluded that transgenic seedlings displayed higher tolerance to drought conditions than control seedlings. In addition, the MDA content of transgenic seedlings in each treatment was significantly higher than that of control seedlings (p < 0.0001, a = 0.05). This suggests that transgenic seedlings were more resistance to osmotic stress than control seedlings. Under all treatments, there was no significant difference in the conductivity between transgenic and control seedlings. Thus, transgenic seedlings did not demonstrate higher tolerance to osmotic stress than control seedlings under any of the treatments.

There was a significant difference between transgenic and control plants in terms of Pro content (p < 0.0001, a = 0.05) under low temperature and salinity treatments, but the difference was less significant (p = 0.0413, a = 0.05) under drought treatment. Because the Pro content of transgenic seedlings was much higher than that of control seedlings, transgenic seedlings exhibited better resistance to osmotic stress.

Tobacco seedlings harbouring the GsLTP gene displayed greater resistance than control seedlings based on membrane permeability and enzymatic activity. Based on chlorophyll content, the GsLTP gene significantly enhanced tolerance to drought, but did not enhance tolerance to low temperature stress or salinity stress. Based on the MDA and Pro content, the LTP gene significantly enhanced resistance to low temperature, drought and salinity. The accumulation of these osmotic protective substances in transgenic seedlings in response to stress is an important biochemical indicator for measuring tolerance to low temperature, drought and salinity. Our results clearly showed that resistance of transgenic tobacco seedlings to drought and salinity was improved (Fig. 4). Compared with control seedlings, all physiological parameters tested were enhanced to various degrees in transgenic tobacco seedlings. Thus, GsLTP improved the tolerance of tobacco plants to drought and salinity stresses.

Table 1

Variance analysis of chlorophyll content, MDA content, Conductance and Pro content under different treatment.
Pr > F	Source	Chlorophyll content	MDA content	Conductance	Pro content
Low temperature	Treat	0.2248	< 0.0001	0.2317	< 0.0001
(4℃)	Data	< 0.0001	< 0.0001	0.0303	< 0.0001
	Repeat	0.4631	0.9256	0.6446	0.8066
Drought treatment	Treat	0.0077	< 0.0001	0.7990	0.0413
	Data	0.0001	0.0005	0.0076	< 0.0001
	Repeat	0.5453	0.6738	0.8940	0.3755
Salt treatment	Treat	0.0101	< 0.0001	0.0795	< 0.0001
	Data	< 0.0001	< 0.0001	0.0041	< 0.0001
	Repeat	0.3382	0.8806	0.7632	0.8378

Table 2

T-tests (LSD) for chlorophy content, MDA content, Conductance and Pro content in different treatment.
T-tests (LSD)	Treat	Low temperature (4 °C)	Drought treatment	Salt treatment
Chlorophyll content	control	0.71847a	0.70110b	0.65486a
Chlorophyll content	LTP	0.73573a	0.89190a	0.94614a
MDA content	control	0.0129333a	0.0110952a	0.0123810a
MDA content	LTP	0.0078667b	0.0080000b	0.0071905b
Conductance	control	81.727a	73.631a	80.064a
Conductance	LTP	86.061a	76.024a	86.879a
Conductance	control	0.045333b	0.036000b	0.049238b
Conductance	LTP	0.077000a	0.052667a	0.082952a
Note: control: wild type plant; LTP: Seedlings transformed with LTP gene

LTPs are widely distributed in plants, animals and microorganisms. They are animportant class of active proteins in plants, accounting for 4% of soluble protein in cells. In vitro studies showed that LTPs bind reversibly to and transport a variety of hydrophobic molecules such as fatty acids, phospholipids, glycolipids, acetyl coenzyme A, steroids, aromatic derivatives and cutin monomer lipid complexes[6]. LTP genes have been isolated from a variety of plants, including six in pepper and 15 in Arabidopsis[28]. In addition, recent rice genome sequence analysis identified 53 nsLTP genes in rice[29]. For example, OsLTPL36 may be involved in lipid absorption and/or transport during seed development in rice[30]. These nsLTPs may be related to mobile signalling factors in systemic acquired resistance processes[31]. The functions of these nsLTPs are affected by low temperature, drought and salinity[32–34], and abscisic acid (ABA) and other abiotic factors can increase expression. These findings suggest that rice LTP gene expression and abiotic stress are closely correlated. However, the exact mechanism of GsLTP in stress responses remains unclear. Some studies indicate that LTPs and some known plant defence response elicitors share similar structural and functional characteristics, including receptor control of plant defence response mechanisms and disease resistance mechanisms[33].

In the present study, we obtained a 369 full-length sequence of the GsLTP gene that encodes a predicted polypeptide of 122 amino acids. Many plants contain multiple LTP gene family members. BLASTp analysis revealed similarity between GsLTP and other LTPs although with some differences between species.

Transgenic tobacco plants harbouring the GsLTP gene displayed significantly higher resistance to low temperature, drought and salt stresses. Overexpression of the LTP gene in tobacco may activate LTP synthesis and the expression of downstream genes. In transgenic plants, LTP gene overexpression can also improve salt tolerance, drought resistance, osmotic stresses, and ABA sensitivity. These results indicate that LTPs make an important roles in osmotic stress signal transduction and responses, ABA signalling[34] and ethylene signalling[35]. Our studies on GsLTP expand our knowledge of plant responses to stresses. Plant resistance is a complex process mediated by the interaction of multiple genes[36], and this is the case for tolerance to drought, salinity and low temperature[24, 37]. Even so, transferring a single gene into a plantcan significantly enhance resistance in some cases[38]. It is generally believed that complex genetic transformation can greatly improve resilience in transgenic plants. In future studies, we will apply multi-gene transfer to achieve even stronger stress resistance and agronomic traits.

We isolated the GsLTP from G. Soja and transformed it into tobacco. Transgenic plants were assessed for stress resistance by analyzing physiological parameters and biochemical indicators following low temperature, drought and salinity stress treatments. GsLTP improved tolerance to drought and salinity to different degrees. However, resistance to low temperature was not enhanced. In summary, genetic transformation of GsLTP into plants can improve resistance to environmental stresses.

Plant materials and growing conditions

The seeds of G.soja G50109 were obtained from the Jilin Academy of Agricultural Sciences (Changchun, China). To remove waxiness and promote germination, treat seeds with sulfuric acid (98%) for 10 minutes, wash them in sterile water 5 times, and store them in darkness for at least 2 days. After that, wild soybean seedlings were transferred to soil and incubated for 19 days at 24–26 °C under a 16 hours light / 8 hours dark cycle condition. Leaves and roots were collected and stored at -80 °C after being snap-frozen in liquid nitrogen.

Wild-type (WT) Nicotiana tabacum Longjiang 911, from Mudanjiang Normal University, China, were used for transformation. Tobacco seeds were soaked for 3−5 h in water, sterilized with 70% ethanol for 30 s, treated with 0.1% mercuric chloride for 3 min, and rinsed with sterile water five times. Finally, all seeds were placed on M₀ medium (1/8 MS + 0.8% agar, pH 5.8). When young leaves reached 2–3 cm, edges were removed, leaves were cut into discs (7 mm diameter) and placed with adaxial sides facing downwards on M₁ medium (MS + 1.0 mg L6-BA + 0.1 mg LNAA + 0.75% agar, pH 5.8) for pre-culturing for 2 to 3 days. Leaf disc incisions began to swell and callus tissue started growing. WT and transgenic lines were treated with 0 mM or 300mMNaCl, or subjected to drought stress, to analyze gene function.

Isolation and sequence analysis of GsLTP

Gene expression profiles were obtained with the soybean gene expression microarray. Salt stress expressed sequence tag (EST) library was used to determine gene expression during early osmotic stress. The GsLTP gene was found to be highly similar to clone pTE-6424 in the NCBI database as revealed by electronic extension using Phrap software. A BLAST analysis was carried out (http://www.ncbi.nlm.nih.gov/blast/) and the full-length sequence was obtained. The full sequence of the ORF was translated from the nucleic acid sequence by DNAMAN software.

The full-length cDNA of GsLTP was obtained by homologous cloning. Total RNA from G. soja G50109 was extracted from soybean leaves usinga GoldScript cDNA Synthesis Kit (Invitrogen, Shanghai, China) and converted into cDNA through reverse transcription. The full- length cDNA of GsLTP was amplified using gene-specific primers 5’-AGATGGCAGAGACATTCC-3’ and 5’-TGCACCTTTCAATAC-3’. The reaction contained 2.5 µl of 10 × PCR buffer (Mg²⁺-free), 3 µl of 25 mM Mg²⁺, 2 µl of 2.5 mM each dNTP, 1 µl of DNA template (DNA content < 1 ng), and 0.2 µl of Taq polymerase (5 U/µl) or Pyrobest TM DNA polymerase. The PCR products were purified and cloned into the pGEM-T vector, and the Pyrobest TM DNA polymerase was used for PCR identification and DNA sequencing. Sequence alignment was performed using DNAMAN. Sequence similarity was verified by BLASTP (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The vector was transformed to Escherichia coli DH5α and cultured on Luria Bertani (LB) solid medium containing ampicillin (100 mg/L).

Construction of the pBI121- GsLTP expression vector

The PCR-amplified LTP gene was cloned into the plant expression vector pBI121, and the insert was verified using forward (5’-TAGGATCC(BamHI)TAAGTCTTTGTTCATTTGAGTAG − 3’) and reverse (5’-TACGAGCTC(SacI)ATATATAGAATTCTGCGACT-3’) primers. PCR was performed as described above, and a 447 bp fragment was identified and purified as described above. Finally, the target plant expression vector harbouring the LTP gene was transformed into Agrobacterium tumefaciens LBA4404 (pAL4404).

Tobacco transformation

The A. tumefaciens LBA4404 strain containing the pBI121-GsLTP vector was transformed into tobacco leaf disks following pre-incubation for 2–3 days. After co-culture for 3−4 days, leaf disks were degermed for 2–3 h with liquid medium containing antibiotics that prohibit Agrobacterium growth. These leaf discs were dried on filter paper and then placed on shoot regeneration media for further selection. Five to six weeks later, small shoots of 3−4 cm in size were transferred to rooting medium. Approximate 14 days later, most seedlings developed proliferate root system. These putative transgenic plantlets were then moved into a humid culture room without sealing for 1 week. Thereafter, seedlings were planted in flower pots (grass peat: sandy soil = 2:1) and grown in an artificial climatic cabinet (26 °C, 126 µmol m^− 2 s^− 1, 16 h day^− 1 illumination, 85–90% relative humidity).

Molecular biological identification

Genomic DNA was extracted from selected transgenic and wild type plants, and integration of the GsLTP gene was confirmed by PCR and Southern blotting using a probe consisting of a 375 bp fragment of the GsLTP gene generated from total DNA in plants digested with BamHI. GsLTP mRNA transcription was determined by RT-PCR. The above experiments were carried out on the T₃ generation of all lines. A total of 180 seedlings were confirmed to be transgenic and used in further stress tolerance tests. The material did not been deposited in a publicly available herbarium.

Analysis of stress tolerance and GsLTP function

Three groups of seedlings at a similar developmental stage (30 transgenic seedlings and 30 untransformed control seedlings per group) were subjected to low temperature (4 °C), salinity (300 mM NaCl) and drought (without water for 2, 4, 6, 8, 10, 12 or 14 days).Chlorophyll content [39], malondialdehyde (MDA) content (TBA assay) [40, 41], proline (Pro) content (ninhydrin assay) [42], leaf membrane permeability (relative conductivity assay)[43] and morphology were investigated for each treatment. Physiological indices and gene function were statistically analyzed using SAS6.12.

LTPs

Lipid transfer proteins

ORF

open reading frame

EST

expressed sequence tag

nsLTPs

Non-specific lipid transfer proteins

MDA

malondialdehyde

Pro

proline

ABA

abscisic acid

Ethics approval and consent to participate: Not applicable

Consent for publication: Not applicable

Availability of data and materials: All data generated or analyzed during this study are included in this

published article.

Competing interests: The authors declare that they have no competing interests.

Funding: This work was supported by National Key Research and Development Projects, grant number 2016YFC0500306-02, Heilongjiang Natural Science Fund Project Plan Mission Statement, grant number C2017030 and Heilongjiang Province Education Project Fund, grant number 12531014. The funders had no role in study design, data collection, interpretation, or decision-making in relation to submission for publication.

Authors’ contributions: DC and JF conceived and designed research. JL and LC conducted experiments. JF contributed new reagents or analytical tools. JW and QM analyzed data. JF wrote the manuscript. All authors read and approved the manuscript.

Acknowledgements: Not applicable.

Wang W, Vinocur B, Altman A. Plant responses to drought, salinity and extreme temperatures: towards genetic engineering for stress tolerance. Planta. 2003;218(1):1–14. https://doi.org/10.1007/s00425-003-1105-5.
Liu Y, Zhang L, Meng S, Liu Y, Zhao X, Pang C, Zhang H, Xu T, He Y, Qi M, et al. Expression of galactinol synthase from Ammopiptanthus nanus in tomato improves tolerance to cold stress. J Exp Bot. 2020;71(1):435–49. https://doi.org/10.1093/jxb/erz450.
Yang Z, Sheng J, Lv K, Ren L, Zhang D. Y2SK2 and SK3 type dehydrins from Agapanthus praecox can improve plant stress tolerance and act as multifunctional protectants. Plant science: an international journal of experimental plant biology. 2019;284:143–60. https://doi.org/10.1016/j.plantsci.2019.03.012.
Liu S, Fukumoto T, Gena P, Feng P, Sun Q, Li Q, Matsumoto T, Kaneko T, Zhang H, Zhang Y, et al. Ectopic expression of a rice plasma membrane intrinsic protein (OsPIP1;3) promotes plant growth and water uptake. The Plant journal: for cell molecular biology. 2019. https://doi.org/10.1111/tpj.14662.
Gouiaa S, Khoudi H. Expression of V-PPase proton pump, singly or in combination with a NHX1 transporter, in transgenic tobacco improves copper tolerance and accumulation. Environmental Science Pollution Research. 2019;26(36):37037–45. https://doi.org/10.1007/s11356-019-06852-x.
Carvalho-Ade O, Gomes V. Role of plant lipid transfer proteins in plant cell physiology-a concise review. Peptides. 2007;28(5):1144–53. https://doi.org/10.1016/j.peptides.2007.03.004.
José-Estanyol M, Gomis-Rüth FX, Puigdomènech P. The eight-cysteine motif, a versatile structure in plant proteins. Plant Physiol Biochem. 2004;42(5):355–65. https://doi.org/10.1016/j.plaphy.2004.03.009.
Liu F, Zhang X, Lu C, Zeng X, Li Y, Fu D, Wu G. Non-specific lipid transfer proteins in plants: presenting new advances and an integrated functional analysis. Journal of experimental botany. 2015;66(19):5663–81. https://doi.org/10.1093/jxb/erv313.
Ji J, Lv H, Yang L, Fang Z, Zhuang M, Zhang Y, Liu Y, Li Z. Genome-wide identification and characterization of non-specific lipid transfer proteins in cabbage. PeerJ. 2018;6:e5379. https://doi.org/10.7717/peerj.5379.
Salminen TA, Blomqvist K, Edqvist J. Lipid transfer proteins: classification, nomenclature, structure, and function. Planta. 2016;244(5):971–97. https://doi.org/10.1007/s00425-016-2585-4.
Boutrot F, Chantret N, Gautier MF. Genome-wide analysis of the rice and Arabidopsis non-specific lipid transfer protein (nsLtp) gene families and identification of wheat nsLtp genes by EST data mining. Bmc Genomics. 2008;9(1):86. https://doi.org/10.1186/1471-2164-9-86.
Zhao J, Wang S, Qin J, Sun C, Liu F. The lipid transfer protein OsLTPL159 is involved in cold tolerance at the early seedling stage in rice. Plant biotechnology journal. 2020;18(3):756–69. https://doi.org/10.1111/pbi.13243.
Smart LB, Cameron KD, Bennett AB. Isolation of genes predominantly expressed in guard cells and epidermal cells of Nicotiana glauca. Plant Mol Biol. 2000;42(6):857–69. https://doi.org/10.1023/a:1006480107407.
Chen Y, Ma J, Zhang X, Yang Y, Zhou D, Yu Q, Que Y, Xu L, Guo J. A novel non-specific lipid transfer protein gene from sugarcane (NsLTPs), obviously responded to abiotic stresses and signaling molecules of SA and MeJA. Sugar Tech. 2017;19(1):17–25. https://doi.org/10.1007/s12355-016-0431-4.
Safi H, Saibi W, Alaoui MM, Hmyene A, Masmoudi K, Hanin M, Brini F. A wheat lipid transfer protein (TdLTP4) promotes tolerance to abiotic and biotic stress in Arabidopsis thaliana. Plant Physiol Biochem. 2015; 89: 64–75. https://doi.org/ 10.1016/j.plaphy.2015.02.008.
Gangadhar BH, Sajeesh K, Venkatesh J, Baskar V, Abhinandan K, Yu JW, Prasad R, Mishra RK. Enhanced Tolerance of Transgenic Potato Plants Over-Expressing Non-specific Lipid Transfer Protein-1 (StnsLTP1) against Multiple Abiotic Stresses. Frontiers in Plant Science 2016; 7(86). https://doi.org/10.3389/fpls.2016.01228.
Pan Y, Li J, Jiao L, Li C, Zhu D, Yu J. A Non-specificSetaria italicaLipid Transfer Protein Gene Plays a Critical Role under Abiotic Stress. Frontiers in Plant Science 2016; 7(151). https://doi.org/10.3389/fpls.2016.01752.
Jung HW, Kim KD, Hwang BK. Identification of pathogen-responsive regions in the promoter of a pepper lipid transfer protein gene (CALTPI) and the enhanced resistance of the CALTPI transgenic Arabidopsis against pathogen and environmental stresses. Planta. 2005;221(3):361–73. https://doi.org/10.1007/s00425-004-1461-9.
Kader JC. LIPID-TRANSFER PROTEINS. IN PLANTS. Annu Rev Plant Physiol Plant Mol. Biol. 1996;47(47):627–54. https://doi.org/10.1146/annurev.arplant.47.1.627.
Kie?Bowicz-Matuk AR, Pascal, Rorat T. The organ-dependent abundance of a Solanum lipid transfer protein is up-regulated upon osmotic constraints and associated with cold acclimation ability. Journal of Experimental Botany. 2008;59(8):2191–203. https://doi.org/10.1093/jxb/ern088.
Kahn TL, Fender SE, Bray EA, O'Connell MA. Characterization of Expression of Drought- and Abscisic Acid-Regulated Tomato Genes in the Drought-Resistant Species Lycopersicon pennellii. Plant Physiol. 1993;103(2):597–605. https://doi.org/10.1104/pp.103.2.597.
Molina A, Diaz I, Carbonero P, Garcíaolmedo F, Vasil IK. Two cold-inducible genes encoding lipid transfer protein LTP4 from barley show differential responses to bacterial pathogens. Molecular General Genetics Mgg. 1996;252(1–2):162–8. https://doi.org/10.1007/BF02173216.
Ouvrard O, Cellier F, Ferrare K, Tousch D, Lamaze T, Dupuis J-M, Casse-Delbart F. Identification and expression of water stress-and abscisic acid-regulated genes in a drought-tolerant sunflower genotype. Plant molecular biology. 1996;31(4):819–29. https://doi.org/10.1007/bf00019469.
Ji W, Li Y, Li J, Dai CH, Wang X, Bai X, Cai H, Yang L, Zhu YM. Generation and analysis of expressed sequence tags from NaCl-treated Glycine soja. BMC Plant Biology. 2006;6(1):4–4. https://doi.org/10.1186/1471-2229-6-4.
Cao L, Yu Y, Ding X, Zhu D, Yang F, Liu B, Sun X, Duan X, Yin K, Zhu Y. The Glycine soja NAC transcription factor GsNAC019 mediates the regulation of plant alkaline tolerance and ABA sensitivity. Plant Molecular Biology. 2017;95(3):253–68. https://doi.org/10.1007/s11103-017-0643-3.
Ge Y, Li Y, Zhu YM, Bai X, Lv DK, Guo D, Ji W, Cai H. Global transcriptome profiling of wild soybean (Glycine soja) roots under NaHCO3 treatment. Bmc Plant Biology. 2010;10(1):153. https://doi.org/10.1186/1471-2229-10-153.
Sun M, Sun X, Zhao Y, Zhao C, Duanmu H, Yu Y, Ji W, Zhu Y. Ectopic Expression of GsPPCK3 and SCMRP in Medicago sativa Enhances Plant Alkaline Stress Tolerance and Methionine Content. Plos One. 2014;9(2):e89578. https://doi.org/10.1371/journal.pone.0089578.
Liu K, Jiang H, Moore SL, Watkins CB, Jahn MM. Isolation and characterization of a lipid transfer protein expressed in ripening fruit of Capsicum chinense. Planta. 2006;223(4):672. https://doi.org/10.1007/s00425-005-0120-0.
Zhu D, Bai X, Chen C, Chen Q, Cai H, Li Y, Ji W, Zhai H, Lv D, Luo X. GsTIFY10, a novel positive regulator of plant tolerance to bicarbonate stress and a repressor of jasmonate signaling. Plant Molecular Biology. 2011;77(3):285–97. https://doi.org/10.1007/s11103-011-9810-0.
Wang X, Zhou W, Lu Z, Ouyang Y, Chol SO, Yao J. A lipid transfer protein, OsLTPL36, is essential for seed development and seed quality in rice. Plant Science An International Journal of Experimental Plant Biology. 2015;239:200–8. https://doi.org/10.1016/j.plantsci.2015.07.016.
Bogdanov IV, Shenkarev ZO, Finkina EI, Melnikova DN, Rumynskiy EI, Arseniev AS, Ovchinnikova TV. A novel lipid transfer protein from the pea Pisum sativum: isolation, recombinant expression, solution structure, antifungal activity, lipid binding, and allergenic properties. Bmc Plant Biology. 2016;16(1):107. https://doi.org/10.1186/s12870-016-0792-6.
Dani V, Simon WJ, Duranti M, Croy RR. Changes in the tobacco leaf apoplast proteome in response to salt stress. Proteomics. 2005;5(3):737–45. https://doi.org/10.1002/pmic.200401119.
Gao C, Wang Y, Liu G, Yang C, Jing J, Li H. Expression profiling of salinity-alkali stress responses by large-scale expressed sequence tag analysis in Tamarix hispid. Plant Mol Biol. 2008;66:245–58. https://doi.org/10.1007/s11103-007-9266-4.
Wu Y, Wang Q, Ma Y, Chu C. Isolation and expression analysis of salt up-regulated ESTs in upland rice using PCR-based subtractive suppression hybridization method. Plant Sci. 2005;168(3):847–53. https://doi.org/10.1016/j.plantsci.2004.10.020.
McDermott L, Kennedy MW, McManus DP, Bradley JE, Cooper A, Storch J. How helminth lipid-binding proteins offload their ligands to membranes: differential mechanisms of fatty acid transfer by the ABA-1 polyprotein allergen and Ov-FAR-1 proteins of nematodes and Sj-FABPc of schistosomes. Biochemistry. 2002;41(21):6706–13. https://doi.org/10.1021/bi0159635.
Wang H, Sun Y, Chang J, Zheng F, Pei H, Yi Y, Chang C, Dong CH. Regulatory function of Arabidopsis lipid transfer protein 1 (LTP1) in ethylene response and signaling. Plant Molecular Biology. 2016;91(4–5):471–84. https://doi.org/10.1007/s11103-016-0482-7.
Huang M-D, Chen T-LL, Huang AH. Abundant type III lipid transfer proteins in Arabidopsis tapetum are secreted to the locule and become a constituent of the pollen exine. Plant physiology. 2013;163(3):1218–29. https://doi.org/10.1104/pp.113.225706.
Jin SX, Arai J, Tian X, Kumar-Singh R, Feig LA. Acquisition of contextual discrimination involves the appearance of a RAS-GRF1/p38 mitogen-activated protein (MAP) kinase-mediated signaling pathway that promotes long term potentiation (LTP). The Journal of biological chemistry. 2013;288(30):21703–13. https://doi.org/10.1074/jbc.M113.471904.
LICHTENTHALER HK, Wellburn AR. Determinations of total carotenoids and chlorophylls a and b of leaf extracts in different solvents. Portland Press Limited. 1983. https://doi.org/10.1042/bst0110591.
Dong W, Wang M, Xu F, Quan T, Peng K, Xiao L, Xia G. Wheat oxophytodienoate reductase gene TaOPR1 confers salinity tolerance via enhancement of abscisic acid signaling and reactive oxygen species scavenging. Plant physiology. 2013;161(3):1217–28. https://doi.org/10.1104/pp.112.211854.
Jia X, Xiaoguang D, Jun Y, Beeching JR, Peng Z. Enhanced reactive oxygen species scavenging by overproduction of superoxide dismutase and catalase delays postharvest physiological deterioration of cassava storage roots. Plant Physiology. 2013;161(3):1517–28. https://doi.org/10.1104/pp.112.212803.
Zhang T, Mo J, Zhou K, Chang Y, Liu Z. Overexpression of Brassica campestris BcICE1 gene increases abiotic stress tolerance in tobacco. Plant Physiol Biochem. 2018;132:515–23. https://doi.org/10.1016/j.plaphy.2018.09.039.
Ben RW, Ben-Saad R, Meynard D, Verdeil JL, Azaza J, Zouari N, Fki L, Guiderdoni E, Al-Doss A, Hassairi A. Ectopic Expression of Aeluropus littoralis Plasma Membrane Protein Gene AlTMP1 Confers Abiotic Stress Tolerance in Transgenic Tobacco by Improving Water Status and Cation Homeostasis. International Journal of Molecular Sciences. 2017;18(4):692. https://doi.org/10.3390/ijms18040692.

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

GsLTP, a Non-Specific Lipid Transfer Protein from Glycine soja, Enhances Drought and Salt Stress Tolerance in Transgenic Tobacco

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

Background

Results

Identification of transgenic tobacco lines

Discussion

Conclusion

methods

Plant materials and growing conditions

Isolation and sequence analysis of GsLTP

Construction of the pBI121- GsLTP expression vector

Tobacco transformation

Molecular biological identification

Analysis of stress tolerance and GsLTP function

Abbreviations

Declarations

References

Status:

Version 1