Identification and Screening of Host Proteins Interacting with ORFV-ORF047&nbsp;Protein

doi:10.21203/rs.3.rs-53434/v1

Download PDF

Research

Identification and Screening of Host Proteins Interacting with ORFV-ORF047 Protein

https://doi.org/10.21203/rs.3.rs-53434/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 26 Jan, 2021

Read the published version in Virology Journal →

You are reading this older preprint version

Read the latest preprint version →

Bankground：Orf virus (ORFV) is a member of the genus parapoxvirus and family poxviridae. The virus has a worldwide distribution and infects sheep, goats, humans, and wild animals. However, due to the complex structure of the poxvirus, the underlying mechanism of the entry and infection by ORFV remains largely unknown. ORFV ORF047 encodes a protein named L1R. Poxviral L1R serves as the receptor-binding protein and blocks virus binding and entry independently of glycosaminoglycans (GAGs). The study aimed to identify the host interaction partners of ORFV ORF047.

Methods: Yeast two-hybrid cDNA library of sheep testicular cells was applied to screen the host targets with ORF047 as the bait. ORF047 was cloned into a pBT3-N vector and expressed in the NMY51 yeast strain. Then, the expression of bait proteins was validated by Western blot analysis.

Results: Sheep SERP1and PABPC4 were identified as host target proteins of ORFV ORF047, and a Co-IP assay further verified their interaction.

Conclusions: New host cell proteins SERP1and PABPC4 were found to interact with ORFV ORF047 and might involve in the viral mRNA translation and replication.

Virology

Protein –protein interactions

Yeast two hybrid

ORFV ORF047

Co-IP

Poxviruses subvert host antiviral responses by their encoding proteins, which mimic, counteract, or interact with various cellular proteins. L1R protein is a myristoylated, 23–29 kDa transmembrane protein present on the outer membrane surface of intracellular virions (INV) expressed during late infection [1, 2]. Poxviral L1R is required for viral entry and fusion with infected cells [3]. Previously, it was thought to be involved in virus assembly and morphogenesis [2], but later it was demonstrated that it is necessary for entry and vaccinia virus (VACV)-induced cell to cell fusion by associating with members of the entry-fusion complex, but not in assembly [4–6]. The monoclonal Ab (mAb) to L1R decreases VACV-induced cell to cell fusion at low pH, exhibits potent virus-neutralizing activity and inhibits virus entry, but the specific role of L1R during viral entry is yet to be elucidated [4]. L1R serves as the receptor-binding protein for entry and blocks viral binding and entry independently of glycosaminoglycans[7]. The L1 protein is conserved in all poxvirus [8].

Orf virus (ORFV), a member of the genus parapoxvirus of poxviridae, causes contagious ecthyma. ORFV causes an infectious disease that commonly affects sheep, goat, and occasionally humans [9]. ORFV ORF047 is a 245 amino-acid (aa) myristoylated polypeptide with a predicted C-terminal transmembrane domain 183–204 aa, also named L1R, the construction similar with VACV L1. Until now, little is known about ORF047, the detailed role of ORF047 during ORFV entry and infection was not be elucidated yet. The best way to investigate the role of a protein is to find out its host interaction proteins. A yeast-two hybrid (YTH) was performed to screen and identify ORFV047's host target proteins against sheep testicular cellular cDNA library. As a result, three host proteins were identified. Further characterization of interactions between ORFV047 and these proteins will contribute to understanding the function of ORFV047 during the infection and entry.

YTH provide a powerful approach to identify protein-protein interaction; however, the split-ubiquitin membrane Yeast-two hybrid (MbYTH) system is a genetic technique to determine the interaction of membrane proteins [10–12], which utilizes complementation between the separable domain of ubiquitin to investigate membrane protein interactions. Several different laboratories have successfully applied the MbYTH system for proteins from a wide range of organisms. The MbYTH system has been used to investigate the interactions between plant sucrose transporters and between a natural resistance-associated macrophage protein and membrane-bound thioredoxin in Brassica juncea [13]. Furthermore, the MbYTH system has recently been used to isolate interacting partners of the human proteins, BAP31 and ErbB3, from human cDNA libraries [14]. As ORF047 encoding L1 protein is a membrane protein, the Split-ubiquitin cDNA libraries of sheep testicular cells were established to screen the host proteins interacting with ORF047.

Animal

3 of Newborn sheep lambs from Gan Su Agricultural-Farm Ranch Co, Ltd

Virus and yeast strains and plasmids

ORFV strain (ORFV/QH01/2010) was isolated from the scar of a clinically ORFV infected sheep from Qinghai [15], was saved in the laboratory of Lanzhou Veterinary Research Institute (LVRI), China. Yeasts strains (NMY51), pBT3-N, pBT3-STE, PPRN-3, pTSu2-APP, pNubG-Fe65 plasmids for YTH experiments were obtained from Shanghai OE Biotech. Co. Ltd (Shanghai, China). 293T cell, pcDNA3.1-HA, and pcDNA3.1-Flag plasmid were kept in our lab. Cells were cultured using RPMI 1640 (Gibco, Grand Island, New York, USA) supplemented with 10% fetal calf serum (Gibco, Grand Island, New York, USA) and 100 mg/ml penicillin/streptomycin in a humidified 5% CO₂ atmosphere at 37 °C.

Construction of YTH cDNA library of sheep testicular cells

All trials were constructed with the approval of the Ethical Committee of the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences. Neonatal sheep were fully anesthetized with isoflurane inhalation anesthetic administered by face mask (1 to 2% isoflurane) followed by exsanguination as an adjunctive method of euthanasia. These animals were placed in dorsal recumbency on the surgical table for placement of vascular introducer sheaths. Preparation of primary neonatal sheep testicular cells was performed as previously described [16] with few modifications. The testicular parenchyma by ophthalmic tweezers and scissors under sterile conditions. Cut the testicular parenchyma into tissue pieces of 1–2 mm size, and the small tissue pieces were then put into D-hanks solution and pipetted gently several times. After standing for 5–10 min, the supernatant was removed, and the pellet was allowed to digest with lysis buffer containing 0.1% IV collagenase (GIBCO) and 0.25% trypsin (GIBCO) at 4 °C for 12 h.

An equal volume of DMEM medium (HyClone) containing 10% fetal calf serum (GIBCO) was then added to stop the enzymatic digestions. After gentle pipetting several times using a Pasteur pipette, the tissue lysate was filtered with a 200-mesh copper wire screen. The digested solution was then collected and centrifuged at 1000 rpm for 10 min. The supernatant was discarded, and the pellet was washed twice with serum-free culture medium. The DMEM medium containing 10% fetal bovine serum was added to resuspend the cells. The cell viability was to determine by trypan blue staining. Then, the cells at a density of 1–2 × 10⁵ cells/mL placed in a 25 mm cell culture flask and were incubated at 37 °C in a humidified incubator with 5% CO₂. After incubation, the culture media containing non-adherent cells were discarded. The DMEM culture medium containing 10% FBS was added to continue purifying the sheep testicular cells and subculture the cells for 5 passages. Finally, the cultural sheep testicular cells were collected and sent to Shanghai OE Biotech. Co. Ltd (Shanghai, China) for construction of YTH cDNA library. The total RNA of sheep testicular cells was extracted and reverse transcribed into 1st strand cDNA. Following the normalization treatment and short fragment removal, the cDNA of sheep testicular cells was cloned into PPRN-3 vectors (Prey Plasmid).

Bait plasmid construction

Previous, the ORF047 gene has been cloned from the DNA of ORFV, and the recombinant plasmid of pGEM- ORF047 was the stock in our laboratory [17]. Based on the characteristics of bait vector, the specific primers (restriction site underlined): -F (5′- ATTAACAAG GCC ATT ACG GCC GGGGCCGCCGCCAGCATCCAGACCACC − 3′), ORF047-R (5′- GACGGACGGCGGAAATTCCGTAAAGGGGCCGCCTCGGCC AATCAGTT − 3′) was designed. Subsequently, the PCR product was cloned and digested with restriction enzyme SfiI (NEB, USA), and inserted into a pBT3-N plasmid. The recombinant pBT3-N-ORF047 plasmid (bait plasmid) was confirmed by restriction enzyme digestion and sequencing (Sangon Biotech, Shanghai, China).

Bait plasmid expression in yeast cells

Following the manufacture's protocols of the Yeast maker™ Yeast Transformation System 2 kit (Cat. No.630439, Clontech, USA), the transformants of pSTU2-APP plasmids were used as a positive control. The pPR3-N plasmid was used as a negative control. The pBT3-N-ORF047, pSTU2-APP, pPR3-N plasmids were transformed into NMY51, respectively. Transformants were grown on SD/-Leu, SD/-Trp agar plates at 30 °C for 3–5 d. To check the expression of ORF047 bait plasmid in NMY51, one colony from the SD/-Trp plate was inoculated into SD/-Trp broth and grown to 0.6 of OD600 at 30 °C, 250 rpm. The total proteins were subsequently extracted from the centrifuged pelleted cells by the Y-PER yeast protein extraction reagent (Thermo, RF-236781). The extracted proteins were separated by 12% SDS-PAGE and electro-blotted onto PVDF membrane (Millipore, Billerica, Massachusetts, USA) for western blot analysis. The ORF047 bait expression was detected with anti-Lex A mouse McAb (Cat. No.SC-390386, Santa Cruz, USA), followed by m-IgGk BP-HRP second antibody (Cat. No.sc-516102 Santa Cruz, USA), with positive signals revealed, all the membranes were imaged using the ChemiDoc XRS + system (Bio-Rad).

The dual membrane function assay of bait plasmid

Following the manufacture's protocols of the YTH System (Clontech, Mountain View, California, USA), the pBT3-N-ORF047 and pOst1-NubI, pBT3-N-ORF047 and pPR3-N, pSTU2-APP and pNubG-Fe65, pSTU2-APP and pPR3-N plasmids were transformed into NMY51, respectively. Transformants were grown on SD/-Trp-Leu, SD/-Trp-Leu-His, SD/-Trp-Leu-His-Ade agar plates at 30 °C for 4 d. Count the number of colonies on all plates (SD/-Trp-Leu-His and SD/-Trp-Leu-His-Ade ) versus nonselective plates SD/-Trp-Leu. If pBT3-N-ORF047 bait is properly expressed and functional in the DUALmembrane functional assay, we should observe between 10% and 100% growth on SD/-Trp-leu-his and SD/-Trp-leu-his-ade plates derived from transformation reaction of pBT3-N-ORF047 and pOst1-NubI plasmids, depending on the expression level of your bait robust growth under selection indicates that your bait is well expressed and that the Cub moiety is accessible for interaction with the Ost1-NubI moiety expressed from the pOst-NubI control prey. It should observe no significant growth on selective plates derived from the transformation reaction of pBT3-N-ORF047 and pPR3-N plasmids, as bait does not interact strongly with the NubG fused nonsense-peptide expressed from the pPR3-N control prey. Transformation reaction of pSTU2-APP and pNubG-Fe65 should yield robust growth under selection since the APP bait (pSTU2-APP) is well expressed and interacts strongly with Fe65 prey fusion. Transformation reaction of pSTU2-APP and pPR3-N(the negative control)should yield considerably fewer colonies than a reaction of pSTU2-APP and pNubG-Fe65. If the bait interacts with the Ost1-NubI control prey, but not with the pPR3-N derived NubG-nonsense-peptide prey, and the bait plasmid could be used in the YTH screening.

YTH screening by co-transformation of bait with prey plasmids

To screen the host proteins to interact with ORFV-047 bait against a NubG-fused cDNA library of sheep testicular cells, pBT3-N-ORF047 and prey plasmids were co-transformed into NMY51 with Yeastmaker™ Yeast Transformation System according to the DUALmembrane starter kits User Manual (Dualsystems biotech). The pBT3-N-ORF047 and prey plasmids were co-transformed into NMY51, and the transformants were then grown on SD/-Trp-Leu, SD/-Trp-Leu-His, SD/-Trp-Leu-His-Ade/X-Gal agar plates at 30 °C for 3–5 d. Blue colonies were patched out onto higher stringency SD/-Trp-Leu-His-Ade/X-Gal agar plates. Primers of pPR3-N-F/R were applied to amplify each insert DNA of potential positive prey plasmids.

Confirmation of the interactions

pBT3-N-ORF047 bait was co-transformed into NMY51 with each prey plasmid in putatively positive hits to confirm the interactions. The prey plasmids were briefly extracted from putatively positive clones using the Easy Yeast Plasmid Isolation Kit (Cat. No. 630467, Clontech, Mountain View, California, USA). Subsequently, each prey plasmid was transformed into E. coli DH5α competent cells (Transgen, Beijing, China), and purified from transformants growing on selected LB/Amp agar plates by using the Plasmid MiniKit I (Cat. No. D6943-02, Omega, Doraville, Georgia, USA). Following this, each putatively positive prey plasmid was co-transformed with pBT3-N-ORF047 bait and pBT3-N plasmids into NMY51 and the co-transformants grown on SD/-Trp-Leu-His-Ade/X-Gal plates to test for interactions. Co-transformant containing pSTU2-APP and pNubG-Fe65, grown on SD/-Trp-Leu-His-Ade /X-Gal, was used as a positive control and co-transformants containing pSTU2-APP and pPR3-N, grown on SD/-Trp-Leu-His-Ade /X-Gal, was used as a negative control. Blue colonies indicated true positive interactions under these conditions.

Positive prey analysis

To verify positive clones, the six prey plasmids were sequenced using the pBT3-N primers. The sequencing results were analyzed by blasted in NCBI, which revealed that three inserts had a 100% sequence identity to that of the three ovis aries genes: databases to analyze the corresponding function..

Construction of PABPC1, SEPR1, FLC, ORF047 expression plasmid

The expression primers were designed based on the published sequences: SERP1 gene(XP_014948090.1), the forward primer, 5′AAGCTTATGGTCGCCAAGCAGCGGA 3′(the underlined sequence is the HindIII site) and the reverse primer,5′AATGAATTCTCACATGCCCATCCTGATAC − 3′ (the underlined sequence is the EcoR I site). FLC gene(XP_014961714.1) AAGCTTATGAGCTCCCAGATTCGTCAG(the underlined sequence is the HindIII site) and the reverse primer, 5' GAATCCCTAGTCGTGCTTGAGGGT3' (the underlined sequence is the EcoR I site). PABPC1 gene (XM_004001826.3), The forward primer, 5'AAGCTTATGAACGCTGCGGCCAGCAGCTAC3' (the underlined sequence is the Hind III site), 5'GCGGCCGCCTAAGAGGTAGCAGCAGCAAC3' (the underlined sequence is the Not I site).

Sheep testicular cells were collected and adjusted to 1⋅10⁷/mL, the cells were washed with PBS by centrifugation at 2000 rpm for 7 min. Total RNA was extracted from the collected cells with the Catrimox-14TM RNA kit (TaKaRa Corporation, China ). cDNA was synthesized at 42 ℃ using oligo (dT)-adaptor primer and avian myeloblastosis virus (AMV) reverse transcriptase. The complete sequence of PABPC1, SEPR1, or FLC was amply from synthesized cDNA based on the product were analyzed by electrophoresis on a 1% agarose gel. The fragment gene with the length of 201 bp, 528 bp, 1983 bp separately was subcloned into pCDNA3.1-flag-N expression vector (Invitrogen, USA). The mutation-free recombination plasmids were confirmed by sequencing and subsequently transformed into JM109 Escherichia coli cells. Recombinant plasmids were selected by blue-white selection (Takara Biotechnology ).

Western blot and co-immunoprecipitation assay

To detect the interaction between ORF047 bait and prey proteins, HEK293T cells were transfected with pcDNA-3.1-HA-ORF047 and cotransfected with either pcDNA-3.1-Flag-FLC or pcDNA-3.1-Flag-SEPR1 pcDNA-3.1-Flag-PABPC plasmids for the Co-IP assay. Cells were harvested and washed two times with cold phosphate-buffered saline (PBS), then pretreated with 0.5 ml NP-40 lysis buffer ( Beyotime, P0013F) with a cocktail of many protease inhibitors (1:1000) centrifuged at 12 000 rpm for 15 min at 4 °C, and the supernatants were collected. For immunoprecipitation, 0.4 ml of cell lysate was incubated with 1.5 mg beads coated with anti-flag antibody (Sigma ) for ≥ 60 min on a rotator at 4 °C, then the tubes were placed on the magnet for 1 min and remove the supernatant, and the beads were washed 3 times in 500 µl pre-chilled lysis buffer, and resuspended in 50 µl 1 ⋅ Laemmli (loading) buffer and boil for 5 min at 95 °C, the tubes were then put on the magnet for 1 min, and the supernatant was transferred to fresh tubes. The proteins were resolved by electrophoresis on 12% Bis-Tris polyacrylamide gels (Shanghai Sangon Biotech, China) and transferred to polyvinylidene fluoride membranes (Immobilon-P Transfer membranes, Millipore). Membranes were blocked for 12 h at 4 °C in 5% (wt/vol) Tris-buffered saline supplemented with 0.1% Tween 20 (TBST)-diluted milk (BSA, Amresco) buffer. Membranes were incubated with primary antibody diluted in 5% (wt/vol) BSA and 1 ⋅ TBST at room temperature. The primary antibodies used include anti-HA (66006-1, Proteintech), anti-FLAG (F3165, Sigma-Aldrich). The blots were detected by the enhanced chemiluminescence detection kit (#1705062, Bio-Rad) after incubation with an appropriate secondary antibody conjugated to horseradish peroxidase. All the membranes were imaged with the ChemiDoc XRS + system (Bio-Rad).

Construction of YTH cDNA library of sheep testicular

Sheep testicular cells were separated and cultured. When the cells were cultured 5–6 generations (Fig. 1a ), then the cells were collected. 5 × 10⁷ cells were obtained and sent to Shanghai OE Biotech. Co. Ltd for cDNA library construction. As a result, the cDNA library titer was 7⋅10⁵ CFU, and the inserted DNAs were from 200 to 2000 bp according to the sequencing results of 40 clones (Fig. 1b). These results indicated that the cDNA library could be used for YTH screening. Besides, the prey plasmid provided by OE Biotech Co. Ltd was 1 mg/ml.

Construction of pBT3-N-ORF047 bait plasmid and ORF047 expression plasmid

The ORF047 gene fragment of 735 bp was amplified from a pGEM-ORF047 plasmid [17]. The construction of pBT3-N-ORF047 bait plasmid was confirmed by restriction enzyme digestion analysis. The bait plasmid is con-transformed with the control plasmids pTSU2-NubI and pPR3-N into NMY51, if white colonies were grown on SD/-Leu and SD/-Trp plates after 4 d culture, the bait was confirmed with no toxicity. To detect the expression of the fusion proteins, each transformant is inoculated in liquid selective medium and grown overnight. Total proteins of the NMY51 transformed with bait plasmid were extracted and detected by Western blot with anti-Lex A mouse mAb. The result showed that the negative control (NMY51 transformed with pPR3-N) did not yield the detected band, the bait was properly expressed and yielded a band of the molecular weight of 28 kDa plus 38 kDs for the Cub-LexA-VP16 fusion, which was consistent with its predicted size (Fig. 2). The positive control of pSTU2-APP plasmid transformed NMY51 yielded a band of a molecular weight of 118.5 kDa (Fig. 2).

The DUALmembrane function assay of the bait plasmid

The positive plasmid (Ost1-NubI) were transformed into NMY51, and subsequently, the transformants were grown on SD/-Trp-Leu, SD/-Trp-Leu-His, SD/-Trp-Leu-His-Ade plates. Co-expression of bait with Ost1-NubI should result in the reconstitution of split-ubiquitin through the strong affinity of wild type Nub for Cub and the concurrent activation of reporter genes. Growth of yeast expressing bait and the Ost1-NubI control signifies that the bait is functional in the DUALmembrane system. However, the negative control plasmid (pPR3-N prey plasmid) and pBT3-N-ORF047 bait plasmid were transformed into NMY51, but co-expression of bait with the NubG-nonsense peptide fusion expressed from the pPR3-N prey vector should not lead to split ubiquitin formation, as NubG has no affinity for Cub, bait is unlikely to interact with the nonsense peptide fused to NubG. Consequently, yeast coexpressing bait and the NubG-nonsense peptide fusion did not grow on selective medium as positive control transformants, co-expression of Cub-fused APP and NubG-fused Fe65 from pTSU2-APP and pNubG- Fe65 should lead to robust growth on selective medium as APP and Fe65 interact with each other and consequently initiate the split ubiquitin mechanism, which confirmed that pBT3-N-ORF047 bait plasmid is functional in the DUALmembrane assay and fit for the conditions of a library screen (Fig. 3).

Sequencing and analysis of positive prey

A total of 30 colonies were grown on selective SD/-Trp-Leu-His agar plates (Fig. 4a). Six blue colonies were grown on SD/-Trp-Leu-His-Ade/X-Gal agar plates (Fig. 4b). To verify the nucleotide sequence of the identified host proteins interacting with pBT3-N-ORF047, blue colonies were inoculated into SD/Leu-Trp broth and grown to 0.6 of OD600 at 30 °C. A total of 6 pPR3-cDNA positive plasmids were patched out onto higher stringency and were sequenced using the primers of pPR3-N-F/R. The sequences were analyzed using the BLAST. The three fragments had 99% similarity with Ovis aries stress-associated endoplasmic reticulum protein 1 (SERP1) (XP_014948090.1), musimon ferritin light chain (FLC) (XP_011998831.1), polyadenylate-binding protein 4 isoform X1 (PABPC4) (XP_004001875.1). The sequences encoded 67, 176, and 661 aa of SEPR1, FLC, and PABPC4.

PABPC4, SEPR1, and FLC physically interact with ORF047

Physical interactions between ORF047 and PABPC1, SEPR1, or FLC were examined by the Co-IP assay using anti-HA antibodies and immunoblotting with anti-Flag antibodies. The expression of ORF047-HA was detected as expected (Fig. 5A). Co-IP was performed with HA mAb coated beads, and the elute was detected with HA and Flag mAb, respectively. As a result, PABPC1, SEPR1, and FLC could be pulled down by HA tag (Fig. 5B, C), indicating a physical interaction between ORF047 and PABPC1, SEPR1, and FLC.

The ORF047 was chosen in this study based on the biological properties of the L1 protein, the most investigated viral protein of the family poxviridae, vaccinia virus (VACV). VACV L1 is synthesized during late infection and is a myristylated component of the INV membrane [18]. Blocking L1 expression aborts morphogenesis and reduces the incorporation of DNA into virions [7]. L1 plays an important role during viral entry; however, a study has suggested that VACV L1 has the function in the entry as a receptor binding proteins by engaging host receptors that are unique from GAGs [4].

Comparative analysis of L1R protein sequences of animal poxviruses showed that a highly conserved myristoylation motif (G-X-X-X-S) ) and six conserved cysteine residues present in all poxviruses [8]. ORF047 which shows tertiary structure similarities to members of the VACV by analysis of tertiary structure homology modeling. The function of ORFV-L1 during entry is unknown, and its vaccine is lacking. In this study, we investigated host proteins that interact with the L1 proteins of ORFV. Several powerful techniques have been developed for identifying and confirming interaction proteins. The YTH screen system is a powerful tool for high-throughput screening of unknown interaction partners [12, 13]. However, a YTH screen always yields a varying number of false-positive candidates, which need to be confirmed by biologically relevant techniques in the cells. The Co-IP assay was a powerful technology for further verification of YTH results.

In this study, the aa sequence analysis of ORF047 revealed that ORF047 possess putative transmembrane domains and encodes a membrane protein (data not shown). The split-ubiquitin membrane YTH utilizes complementation between separable domains of ubiquitin to study membrane protein interaction [13]. Therefore, the split-ubiquitin membrane cDNA library of sheep was constructed. By way of screening and Co-IP, we have identified three host proteins interacting with ORF047. There is probably other host protein that interacts with ORF047, but it was not detected in our screening, probably because the cDNA library may not contain all the clones.

PABPCs family have five members, and previous studies have shown that PABPCs play important roles in translation, control the rate of mRNA deadenylation, and participate in mRNA decay [19]. PABPC4, initially described as inducible poly(A) binding protein, is a homology of PABPC expressed in most cell types [20, 21]. SEPR1, also known as ribosome-associated membrane protein 4, demonstrates a role in controlling membrane protein biogenesis at the ER [22, 23]. These two host proteins involve in many cellular processes, such as SERP1, can cause the accumulation of unfolded proteins. However, the role and relationship about PABPC4 and SEPR1 with ORFV ORF047 encoded protein needs further investigation.

In this study, ORF047 was used as bait to screen its interacting host protein from the cDNA library of sheep testicular cells, and three host proteins PABPC4, and SEPR1 were screened and verified. It was for the first time that PABPC4 and SEPR1 were found to interact with ORF047.

ORFV

Orf virus; GAGs:glycosaminoglycans; YTH:Yeast two-hybrid; INV:intracellular virions; MbYTH:membrane Yeast-two hybrid; Co-IP:co-immunoprecipitation; VACV:vaccinia virus; PABPC4:polyadenylate-binding protein 4 isoform X1; SEPR1; stress-associated endoplasmic reticulum protein 1; FLC:ferritin light chain

Acknowledgments

This study was made possible by the invaluable assistance provided by the livestock and poultry zoonotic diseases team staff of lan zhou veterinary reaearch institute, We thank Ms lili and Dr. Baoquan Fu for technical assistance.

Authors’ contributions

GC, XH, did experiment and analyzed the date, prepared the original draf. HJ, YF,XW,ZL, performed experiment and helped with the manuscript writing. WL ZJ designed the experiment and helped with the preparation of the final manuscript. All authors have read and approved the final version of the manuscript.

Ethics approval and consent to participate

All trials were constructed with the approval of the Ethical Committee of the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences. All participants were provided with a written consent for the purpose of this study. The study objectives were explained to all participants before obtaining the informed consent.

Availability of data and materials
Data and materials are available upon request from the corresponding author.

Consent for publication
Not applicable.

Competing interests
The authors declare that they have no competing interests. The result of this study does not reflect the opinion of the funding sources. All authors have read and approved the final version of this manuscript.

Author details
¹State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Public Health of Ministry of Agriculture, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou 730046, China; ²School of Public Health, Lanzhou University, Lanzhou 730046, China

Funding

This work was supported by National Natural Science Funds (31402199). 13th Five-Year Plan National Science and Technology Support Program(2017YFD0500903).

Wolffe EJ, Vijaya S, Moss B. A myristylated membrane protein encoded by the vaccinia virus L1R open reading frame is the target of potent neutralizing monoclonal antibodies. Virology. 1995;211:53–63.
Ravanello MP, Hruby DE. Conditional lethal expression of the vaccinia virus L1R myristylated protein reveals a role in virion assembly. J Virol. 1994;68:6401–10.
Bisht H, Weisberg AS, Moss B. Vaccinia virus l1 protein is required for cell entry and membrane fusion. J Virol. 2008;82:8687–94.
Golden JW, Josleyn MD, Hooper JW. Targeting the vaccinia virus L1 protein to the cell surface enhances production of neutralizing antibodies. Vaccine. 2008;26:3507–15.
Shinoda K, Wyatt LS, Irvine KR, Moss B. Engineering the vaccinia virus L1 protein for increased neutralizing antibody response after DNA immunization. Virol J. 2009;6:28.
Foo CH, Whitbeck JC, Ponce-de-Leon M, Saw WT, Cohen GH, Eisenberg RJ. The myristate moiety and amino terminus of vaccinia virus l1 constitute a bipartite functional region needed for entry. J Virol. 2012;86:5437–51.
Foo CH, Lou H, Whitbeck JC, Ponce-de-Leon M, Atanasiu D, Eisenberg RJ, et al. Vaccinia virus L1 binds to cell surfaces and blocks virus entry independently of glycosaminoglycans. Virology. 2009;385:368–82.
Karki M, Kumar A, Venkatesan G, Arya S, Pandey AB. Genetic analysis of L1R myristoylated protein of Capripoxviruses reveals structural homogeneity among poxviruses. Infect Genet Evol. 2018;58:224–31.
Caravaglio JV, Khachemoune A. Orf Virus Infection in Humans: A Review With a Focus on Advances in Diagnosis and Treatment. J Drugs Dermatol. 2017;16:684–9.
Thaminy S, Miller J, Stagljar I. The split-ubiquitin membrane-based yeast two-hybrid system. Methods Mol Biol. 2004;261:297–312.
Stagljar I, Korostensky C, Johnsson N, te Heesen S. A genetic system based on split-ubiquitin for the analysis of interactions between membrane proteins in vivo. Proc Natl Acad Sci U S A. 1998;95:5187–92.
Fetchko M, Stagljar I. Application of the split-ubiquitin membrane yeast two-hybrid system to investigate membrane protein interactions. Methods. 2004;32:349–62.
Marik A, Naiya H, Das M, Mukherjee G, Basu S, Saha C, et al. Split-ubiquitin yeast two-hybrid interaction reveals a novel interaction between a natural resistance associated macrophage protein and a membrane bound thioredoxin in Brassica juncea. Plant Mol Biol. 2016;92:519–37.
Thaminy S, Auerbach D, Arnoldo A, Stagljar I. Identification of novel ErbB3-interacting factors using the split-ubiquitin membrane yeast two-hybrid system. Genome Res. 2003;13:1744–53.
Jia HJ, Zhan LL, Wang XX, He XB, Chen GH, Zhang Y, et al. Transcriptome analysis of sheep oral mucosa response to Orf virus infection. PLoS ONE. 2017;12.
Zhou JSMH, Guo QS. Culturing of ovine testicular cells and observation of pathological changes of the cells innoculated with attenuated sheep poxvirus. Chin J Vet Sci Tech. 2004;9:71–4.
Guohua Chen. Wang HJ,XHe,C., Jing Q., Zhizhong Jing. orf Virus ORF047 gene eukaryotic expression and cell localization. Chinese Journal of Zoonosis. 2018;34:67 ~ 70.
Ravanello MP, Hruby DE. Characterization of the vaccinia virus L1R myristylprotein as a component of the intracellular virion envelope. J Gen Virol. 1994;75(Pt 6):1479–83.
Liu D, Yin B, Wang Q, Ju W, Chen Y, Qiu H, et al. Cytoplasmic poly(A) binding protein 4 is highly expressed in human colorectal cancer and correlates with better prognosis. J Genet Genomics. 2012;39:369–74.
Burgess HM, Richardson WA, Anderson RC, Salaun C, Graham SV, Gray NK. Nuclear relocalisation of cytoplasmic poly(A)-binding proteins PABP1 and PABP4 in response to UV irradiation reveals mRNA-dependent export of metazoan PABPs. J Cell Sci. 2011;124:3344–55.
Gorgoni B, Gray NK. The roles of cytoplasmic poly(A)-binding proteins in regulating gene expression: a developmental perspective. Brief Funct Genomic Proteomic. 2004;3:125–41.
Faria D, Lentze N, Almaca J, Luz S, Alessio L, Tian Y, et al. Regulation of ENaC biogenesis by the stress response protein SERP1. Pflugers Arch. 2012;463:819–27.
Yamaguchi A, Hori O, Stern DM, Hartmann E, Ogawa S, Tohyama M. Stress-associated endoplasmic reticulum protein 1 (SERP1)/Ribosome-associated membrane protein 4 (RAMP4) stabilizes membrane proteins during stress and facilitates subsequent glycosylation. J Cell Biol. 1999;147:1195–204.

Download PDF

Journal Publication

published 26 Jan, 2021

Read the published version in Virology Journal →

Editorial decision: Major revision
10 Sep, 2020
Review #1 received at journal
27 Aug, 2020
Review #2 received at journal
27 Aug, 2020
Reviewer #1 agreed at journal
14 Aug, 2020
Reviewer #2 agreed at journal
14 Aug, 2020
Reviewers invited by journal
11 Aug, 2020
Editor assigned by journal
10 Aug, 2020
Editor invited by journal
09 Aug, 2020
Submission checks completed at journal
07 Aug, 2020
First submitted to journal
06 Aug, 2020

You are reading this older preprint version

Read the latest preprint version →

Identification and Screening of Host Proteins Interacting with ORFV-ORF047 Protein

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Material And Methods

Animal

Virus and yeast strains and plasmids

Construction of YTH cDNA library of sheep testicular cells

Bait plasmid construction

Bait plasmid expression in yeast cells

The dual membrane function assay of bait plasmid

YTH screening by co-transformation of bait with prey plasmids

Confirmation of the interactions

Positive prey analysis

Construction of PABPC1, SEPR1, FLC, ORF047 expression plasmid

Western blot and co-immunoprecipitation assay

Results

Construction of YTH cDNA library of sheep testicular

Construction of pBT3-N-ORF047 bait plasmid and ORF047 expression plasmid

Sequencing and analysis of positive prey

PABPC4, SEPR1, and FLC physically interact with ORF047

Discussion

Conclusion

Abbreviations

Declarations

References

Status:

Journal Publication

Version 1