Patient samples
Glioma and adjacent brain tissues included in this study were obtained from primary glioma patients undergoing elective craniotomy at West China Hospital between January 2019 and January 2020 (Supplementary Table. 1). All human studies were approved by the Institutional Review Board of West China Hospital of Sichuan University (project identification code: 2018.569). All patients provided written informed consent. The diagnoses of glioma grade were made by three independent pathologists. We used fluorescence-guided surgery (FGS), e.g. 5-aminolevulinic acid (5-ALA) to achieve intraoperative visualization of tumor tissue under the microscope and distinguish the tumors from normal adjacent tissues. Clinical samples obtained from patients were used for detection the mRNA and protein levels.
Bioinformatic analysis
Biomarker data and clinical information of The Cancer Genome Atlas Research Network (TCGA) and the Chinese Glioma Genome Atlas (CGGA) LGG-GBM cohorts were downloaded from TCGA (https://portal.gdc.cancer.gov) and CGGA (http://www.cgga.org.cn) repository. Normalized RNA-seq data of 708 samples from 681 cases in TCGA were downloaded using R with the TCGAbiolinks package. And mRNAseq_325 data of 325 samples from 325 cases in CGGA were also downloaded. IDH mutation was determined by merging IDH1 codon 132 and IDH2 codon 172 mutations. Chromosome 1p19q co-deletion was determined by 1p32 and 19q13 segment focal CNV value less than -0.3. MGMT promoter methylation level bins were divided using the 10% and 40% percentiles of mean beta value of probes between 131264896 and 131265737 on chromosome 10 (GRCh38 genome). For survival analysis, patients were divided into low and high gene expression groups by median expression level or 95% percentile of MTCH2 expression in normal brain tissue. Hazard ratio for expression was tested using log rank test. Gene expression is presented as normalized FPKM. Correlation and survival analysis were conducted in R using grid and survminer packages.
Cell culture and siRNAs transfection
Human glioblastoma cell lines U-87 MG, U-251 MG and A172 cell lines were obtained from Type Culture Collection of the Chinese Academy of Sciences (CTCC, Shanghai, China). Glioma cells were maintained at DMEM (Hyclone) with 10% FBS (PAN), and cultured under 5% CO2 at 37°C incubator. All cells were validated by Short Tandem Repeat (STR) analysis. For MTCH2 knockdown, targeted siRNA were transfected into cultured glioma cells using Lipofectamine RNAiMAX reagent (Invitrogen) in Opti-MEM (Invitrogen) over 72 hours. The siRNA sequences are as follow: siRNA MTCH2#1: sense 5'-GGUAAAGUUUUACAGCAUUTT-3'; antisense 5'-AAUGCUGUAAAACUUUACCAT-3'; siRNA MTCH2#2: sense 5'-GAGCCGAGGAAAUAGCUUATT-3'; antisense 5'- UAAGCUAUUUCCUCGGCUCAT-3'.
Primary cell culture of mouse neurons and astrocytes
To compare the MTCH2 protein levels in primary brain cells with glioma cells, we set up experiments to culture primary mouse neurons and astrocytes. Mouse cortical neuron cultures were performed following the standard methods (24). Briefly, cerebral cortex tissues from mouse embryos of 18.5 days were dissected and digested with Papain and DNAse. Then digested neurons were plated in 6-well culture plates with a density of 1×106 cells per well and harvested at DIV 14 for Western blots (25). Primary mouse astrocytes were cultured from cerebral cortex from newborn mouse as described, and digested cells were planted in MEM supplemented with 10% Horse Serum and antibiotics. Cultured astrocytes were then harvested for Western blots.
Immunofluorescence
For immunofluorescence assay to observe MTCH2 cellular localization, A172 cells were cultured on coverslips over 48 hours. For Mito-Tracker staining, A172 cells were incubated with the Mito-Tracker dye (Invitrogen, 200 nM) in DMEM at 37°C incubator for 15 minutes (mins). Then, cells were fixed with 4% paraformaldehyde (PFA, Sigma) solution at room temperature for 30 mins. After permeabilization with 0.25% Triton X-100 in PBS, cells were blocked with 10% goat serum and incubated with primary antibodies (anti-MTCH2, Proteintech) overnight at 4°C. For F-actin staining, 20 nM rhodamine-phalloidin (Thermo) diluted with PBS was applied to PFA-fixed cells that were permeabilized. Then cells were washed with PBS for three times and incubated with ALEXA FLUOR 488/594 secondary antibodies, and mounted slides using ProLong® Gold Antifade Reagent with DAPI (Invitrogen). Images were acquired using Olympus BX63 microscope.
Cell apoptosis assay
To detect cell apoptosis, we conducted flow cytometry and Hoechst staining in glioma cells treated with temozolomide (Selleck Chemicals, 200 μM). For flow cytometry, glioma cells were cultured with 60~80% density in 6-well plate. After cells were transfected with siRNA-MTCH2 and subsequent temozolomide treatment for 48 hours, cells were detached by 0.25% trypsin (Invitrogen) and applied with Annexin V Alexa Fluor647/7-AAD kit (Beijing 4A Biotech) for flow cytometry on a Beckman cytoflex. For Hoechst 33258 staining, cells were cultured on coverslips overnight, and treated as above. Then cells were fixed by 4% paraformaldehyde (PFA) solution and incubated with Hoechst 33258 staining kit (Beyotime) as manufacture instructions. Images were acquired using Olympus BX63 microscope, and cell counting was performed by Image Pro Plus software.
Scratch wound healing assay
To detect the effect of MTCH2 on cell migration of glioma cells, we performed scratch wound healing assay as previous described (26). Briefly, glioma cells were seeded in 6-wells plate overnight, and then siRNA MTCH2 were transfected into cells when cells reached at least 90% density. Cells were wounded with a 200 μL pipette tip and washed 3 times by PBS to remove detached cells. During the migration, glioma cells were cultured in DMEM without FBS. Images were continuously captured in period days and analyzed by ImageJ software.
Transwell migration and invasion assay
To evaluate the effect of MTCH2 on cell migration/invasion of glioma cells, we performed transwell migration and invasion assays, using chambers (8.0 μm) in 24-well plates (Corning, USA). For migration assay, U87 MG cells were seeded in the upper chamber with a density of 2×104 cells/well, and the lower filled with DMEM containing 5% FBS as a chemoattractant. After 8 hours, the upper surface of the membrane was scrubbed to remove all non-invaded cells. Cells migrated to the lower surface were fixed and stained with 0.5% crystal violet solution. For invasion assay, cells were seeded into the upper chamber pre-coated with BioCoat Matrigel (BD, USA) according to the manufacturer's protocol. After 24 hours, the cells invaded were fixed and stained with crystal violet. The invaded cells were calculated by ImageJ and quantified for statistical analysis from three independent experiments.
Cell lysis solution and western blots
Total cells were lysed with 2% SDS solution plus protease and phosphatase inhibitors (Thermo Scientific). Protein concentrations were tested by BCA kit and equivalent proteins were loaded into SDS-PAGE. Following western blots were performed according to standard procedures. The primary antibodies were list as follow: MTCH2 (Proteintech, Cat#16888-1-AP), Beta actin (Boster Biological Technology, Cat#BM0627), PDHE1-A (Abcam, Cat#ab110334), GFAP (Millipore, Cat#G3893), Tom20 (Santa Cruz Biotechnology, Cat#sc-136211), Tom40 (Abcam, Cat#ab185543), MMP-9 (Cell Signaling Technology, Cat#3852), N-cadherin (Cell Signaling Technology, Cat#4061), Vimentin (Cell Signaling Technology, Cat#5741), 4-HNE (Abcam, Cat#ab48506), BcL-2 (Santa Cruz Biotechnology, Cat#sc-7382), Bax (Millipore, Cat#06-499), phospho-AKT (Thr308) (Cell Signaling Technology, Cat#2965), phospho-AKT (Ser473) (Cell Signaling Technology, Cat#4060), AKT (Cell Signaling Technology, Cat#9272), phospho-S6 (Ser240/244) (Cell Signaling Technology, Cat#2215), S6 (Cell Signaling Technology, Cat#2217), phospho-4EBP1 (Thr37/46) (Cell Signaling Technology, Cat#9459), total OXPHOs rodent antibody cocktail (Abcam, Cat#110413), phospho-Cofilin1 (Ser3) (Cell Signaling Technology, Cat#3313), Cofilin1 (Cell Signaling Technology, Cat#5175), PARP (Abclonal, Cat#A0942) and cleaved caspase 3 (Cell Signaling Technology, Cat#9661).
RNA extraction and real-time PCR
Trizol reagent was used to extract total RNA following manufacturer instructions. RNA reversed transcription using PrimeScriptTM RT reagent Kit (Takara), and analyzed by quantitative PCR (qPCR) using SYBR Premix Ex TaqTM II (Takara) in Bio-Rad iQ5 system. Relative gene expression was normalized to β-actin. qPCR primers were as follows:
Targets
|
Forward 5'-3'
|
Reverse 5'-3'
|
MTCH2
|
GGTCTTGTTCCTCGCCTTCT
|
TGGTAGAAACCCCACTGTCC
|
MMP-9
|
GGGACGCAGACATCGTCATC
|
TCGTCATCGTCGAAATGGGC
|
β-actin
|
CATGTACGTTGCTATCCAGGC
|
CTCCTTAATGTCACGCACGAT
|
Statistical analysis
Statistical analysis was conducted in GraphPad Prism (v6.01, GraphPad Software, Inc). Data were expressed as mean ± SEM. Differences between groups were tested for statistical significance using Student’s t test for two-group comparisons, and one-way analysis of variance (ANOVA) followed by the Tukey post hoc tests for multi-group comparisons. A p-value < 0.05 (*) was considered statistically significant, and **indicates p < 0.01, and *** p < 0.001.