Association of AGT rs2493132 Polymorphism and the Risk of Coronary Artery Disease in Patients with Non-alcoholic Fatty Liver Disease in Chinese Han Population

doi:10.21203/rs.3.rs-54000/v1

Download PDF

Research article

Association of AGT rs2493132 Polymorphism and the Risk of Coronary Artery Disease in Patients with Non-alcoholic Fatty Liver Disease in Chinese Han Population

https://doi.org/10.21203/rs.3.rs-54000/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Previous studies proved that AGT gene polymorphisms were associated with the serum lipids metabolism; however, it is not clear whether AGT rs2493132 increases the risk of NAFLD and CAD. This study was designed to investigate the relationship between AGT rs2493132 gene polymorphism and the developing risk of NAFLD and CAD in Chinese Han population.

Methods: A total of 142 NAFLD patients, 109 NAFLD + CAD patients, and 246 health controls were included in this study. PCR method was used to measure AGT genotype. The anthropometric and clinical data were measured in clinical laboratory department of Qingdao Municipal Hospital. Statistical analyzes were conducted using the SPSS statistical software, version 21.0.

Results: The AGT rs2493132 CT + TT genotype was an important risk factor for CAD in patients with NAFLD (OR = 1.785; 95%CI: 1.061-3.003; P = 0.029), and the risk of CAD in patients with NAFLD was still marked after adjusted for gender, age, and BMI (OR = 4.718; 95%CI: 1.502-14.824; P = 0.008). The T allele of AGT rs2493132 also significantly increased the risk of CAD in NAFLD patients (OR = 2.436; 95% CI: 1.184-5.011, P = 0.016) after adjusted for age, gender, and BMI. In addition, AGT rs2493132 T allele carriers possess the higher TC and LDL levels compared to the non-carriers in all the participants (Both P < 0.05).

Conclusions: AGT rs2493132 CT + TT genotype and T allele significantly increased the developing risk of CAD in the patients with NAFLD in Chinese Han population. AGT rs2493132 T allele associated with the increased serum TC and LDL levels.

Gastroenterology & Hepatology

Cardiac & Cardiovascular Systems

Angiotensinogen

Non-alcoholic fatty liver disease

Coronary artery disease

Polymorphism

Non-alcoholic fatty liver disease (NAFLD) is the most prevalent chronic liver disease, and the prevalence of NAFLD in the Asian was as high as 29.62% [1]. As a hepatic manifestation of metabolic syndrome, NAFLD has been proven to be an independent risk factor for cardiovascular disease (CVD) [2–5]. The occurrence rate of coronary artery disease (CAD) increased 4.7 times in the adult NAFLD population and the severity of CAD was also significantly associated with the presence of NAFLD [6]. Multiple factors contribute to the pathogenesis of NAFLD and CAD [7]. Accumulated evidence suggested that gene polymorphism is an important risk factor not only for the occurrence of NAFLD or CAD in the general population, but also for the occurrence of CAD in the NAFLD patients [3, 8]. Simons et al. investigated the effect of three variants in the NAFLD susceptibility genes TM6SF2, MBOAT7, and PNPLA3 on the developing risk of CAD in the NAFLD patients [9]. The results showed that TM6SF2 rs5854292 and PNPLA3 rs738409 possess the protective effect for the development of CAD, while the variant in MBOAT7 rs641738 exerted a neutral effect on CAD risk. Glucokinase regulatory protein gene (GCKR) participates in the de novo lipogenesis, and the case-control studies suggested that the variation of GCKR rs780094 was tightly related to NAFLD [10, 11]. A recent meta-analysis (include 274,625 individuals) demonstrated a significant association between the GCKR rs780094 and the risk of CAD [12]. The different effects of gene polymorphisms on plasma lipids may be a vital mediator between NAFLD and the risk of CAD [3].

Angiotensinogen (AGT) mainly derives from hepatocytes, and is the precursor of all the angiotensin peptides, which plays an undoubted role in blood pressure regulation [13–15]. In addition, AGT has been also found possesses the potential role on metabolic disorder [16]. In the low-density lipoprotein receptor-/- mice, down-regulated the expression of AGT could maintain the lower plasma cholesterol levels and minimize atherosclerotic damage compared to the wild-type mice, whereas up-regulated the expression of AGT could increase the risk of atherosclerosis, diet-induced body weight gain and liver steatosis [14]. In addition, Tao et al. found that hepatocyte-specific AGT deficient in mice could protect the mice from western diet-induced liver steatosis and resisted to insulin resistance [16]. Recently, several clinical studies have pointed out the relationship between AGT gene polymorphism and the regulation of serum lipid metabolism. AGT rs699 CC genotype was significantly associated with high-density lipoprotein (HDL) levels in peripheral arterial diseases patients [17]. Khamlaoui et al. reported that AGT M235T genotype was associated with the serum levels of low-density lipoprotein (LDL) and total cholesterol (TC) (all P < 0.05), and AGT M235T polymorphism increase the risk of overweight-obesity [18]. Ji et al. suggested that AGT rs2493132 was associated with the hypertension in Chinese Han population, which indicated that AGT rs2493132 might be the risk factor for CAD [19].

Although the relationship of AGT gene polymorphisms with the serum lipids metabolism and CAD has been investigated in several studies, but the definite relationship of AGT gene polymorphism with the developing risk of NAFLD and CAD is remains unclear. This study was designed to investigate the effect of AGT rs2493132 on the developing risk of NAFLD and CAD in the Chinese Han population, and investigate the effect of AGT rs2493132 on the serum lipid profiles.

Study subjects

This study was approved by the ethics committee of Qingdao Municipal Hospital and was conducted according to the principles of the Helsinki declaration and its appendices [20]. All the participants filled out the informed consent form before this study. From July 2017 to December 2018, a total of 109 NAFLD patients with CAD (NAFLD + CAD), 142 NAFLD patients without CAD, and 246 healthy controls were recruited in Qingdao Municipal Hospital. The diagnosis of NAFLD was based on the guidelines of the American association for the study of liver disease (AASLD) [21]. CAD was diagnosed by a percutaneous coronary angiography, with at least 50% stenosis in at least one of the coronary arteries. Subjects with other liver diseases, such as autoimmune hepatitis, drug-induced hepatitis, viral hepatitis, hepatocellular carcinoma, were excluded from this study.

Biochemical Analyses

Demographic characteristics (age and gender), anthropometric (height and weight), and blood pressure were recorded by the questionnaire. The body mass index (BMI) was calculated as weight (kg) / height (m)². Blood samples were collected from each subject's median vein for biochemical analysis following 12 hours of fasting. Serum aspartic aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), gamma-glutamine transpeptidase (GGT), triglyceride (TG), TC, HDL, LDL, and fasting blood glucose (FPG) were detected in clinical laboratory department of our hospital.

Genomic Dna Extraction And Genotyping

Genomic DNA was extracted from EDTA anticoagulated whole blood using TIANamp Blood DNA Kit (Tiangen Biochemical Technology, Beijing, China) and stored at -20 °C until use. AGT rs2493132 was genotyped by polymerase chain reaction with the corresponding primers 5′- ACGTTGGATGGGATTTGACATGAGAGTGGC-3′ and 5′- ACGTTGGATGATTTACCTAGCCTCCGGATG − 3′. ABI veriti-384 Prism sequence detection system was used to detect the genotype of rs2493132 by direct DNA sequencing, and MassARRAY TYPER4.0 software (Agena, Inc) was used to analyze the original data.

Statistical analysis

All analysis was performed using SPSS software (version 21.0; SPSS, Chicago, IL, USA). The Pearson’s χ² test was used to analyzing the Hardy-Weinberg equilibrium in the distributions of genotype among subjects. Continuous variables were compared by unpaired Student’s t-test, and expressed as mean ± standard deviation (SD) when normally distributed. Categorical variables were compared using the Chi-square test. The association between AGT rs2493132 and the risk of NAFLD and NAFLD + CAD was calculated by computing the crude and adjusted odds ratios (ORs) and 95% confidence intervals (CI) from the logistic regression analyses. Statistical significance was considered as P < 0.05.

Clinical characteristics of the study population

The clinical characteristics of 142 patients with NAFLD (mean age 40.95 ± 5.96 years), 109 patients with NAFLD + CAD patients (mean age 59.05 ± 7.95 years), and 246 health controls (mean age 47.40 ± 11.52 years) were summarized in the Table 1. As the results shown, patients with NAFLD had the higher BMI, serum ALT, AST, ALP, TG levels, SBP and DBP than the health controls (all P < 0.05). There were the high levels of BMI, serum ALT, ALP, TG levels, and SBP, and the low serum levels of TC, HDL, LDL in the patients with NAFLD + CAD compared to the patients with NAFLD (all P < 0.05). In addition, patients with NAFLD + CAD had the higher BMI, serum levels of GGT, TC, HDL, and LDL, and the lower serum ALP level and SBP than patient with NAFLD (all P < 0.05).

Table 1

Basic Characteristics of the Study Population
Characteristics	Controls (n = 246)	NAFLD (n = 142)	NAFLD + CAD (n = 109)	P1	P2	P3
Male/Female	149/97	95/47	75/34	0.251	0.139	0.750
Age (y)	47.40 ± 11.52	40.95 ± 5.96	59.05 ± 7.95	< 0.001	< 0.001	< 0.001
BMI (kg/m²)	23.65 ± 3.23	26.82 ± 2.77	25.27 ± 2.61	< 0.001	< 0.001	< 0.001
ALT (U/L)	22.64 ± 18.20	34.60 ± 25.42	30.06 ± 28.16	< 0.001	0.003	0.183
AST (U/L)	21.88 ± 6.26	24.16 ± 8.86	23.53 ± 13.96	0.003	0.133	0.670
GGT (U/L)	26.00 ± 14.67	35.80 ± 18.28	29.36 ± 15.70	< 0.001	0.061	0.005
ALP (U/L)	70.72 ± 21.08	70.95 ± 19.06	85.60 ± 20.77	0.915	< 0.001	< 0.001
FPG (mmol/L)	5.36 ± 7.64	5.54 ± 6.28	6.02 ± 2.17	0.817	0.381	0.447
TG (mmol/L)	1.40 ± 0.97	2.22 ± 3.10	2.10 ± 3.85	< 0.001	0.008	0.789
TC (mmol/L)	5.26 ± 1.53	5.42 ± 0.95	4.64 ± 1.23	0.259	< 0.001	< 0.001
HDL (mmol/L)	1.34 ± 0.54	1.24 ± 0.26	1.04 ± 0.27	0.08	< 0.001	< 0.001
LDL (mmol/L)	3.19 ± 1.42	3.28 ± 0.59	2.81 ± 0.89	0.528	0.011	< 0.001
SBP (mmHg)	118.65 ± 13.21	123.53 ± 13.01	133.83 ± 17.40	0.002	< 0.001	< 0.001
DBP (mmHg)	81.18 ± 11.36	84.32 ± 9.16	80.78 ± 9.70	0.012	0.771	0.030

Genotypes And Allele Distribution Of Agt Rs2493132

The genotype distributions of AGT rs2493132 in health controls group, NAFLD group and NAFLD + CAD group were confirmed with the Hardy-Weinberg equilibrium (P = 0.921, 0.298, and 0.579; respectively) (Table 2). There was no significant difference of the genotype distributions of AGT rs2493132 between the NAFLD group and health controls group, and between the NAFLD + CAD group and NAFLD group (Both P > 0.05). In addition, the distribution of AGT rs2493132 allele between the NAFLD group and health controls group, and between the NAFLD + CAD group and NAFLD group were also not significant different (Both P > 0.05) (Table 3). The results of logistic regression analysis suggested that AGT rs2493132 CT + TT genotype was the important risk factor for the CAD in the NAFLD patients (OR = 1.785, 95%CI: 1.061–3.003, P = 0.029). The AGT rs2493132 T allele did not show the tightly association with the risk of CAD in the NAFLD patients. After adjusted for age, gender, and BMI, both the AGT rs2493132 CT + TT genotype and T allele were the significant risk factors for the development of CAD in the NAFLD patients (OR = 4.718, 95%CI: 1.502–14.824, P = 0.008; OR = 2.436, 95%CI: 1.184–5.011, P = 0.016, respectively) (Table 4).

Table 2

Results of the Hardy-Weinberg Equilibrium^a
Groups	χ²	P value
controls	0.010	0.921
CAD - NAFLD	1.083	0.298
CAD + NAFLD	0.308	0.579
^aData were compared by chi-square test

Table 3

Distribution of AGT rs2493132 genotypes and alleles in Study Group
Genotype	controls	NAFLD	NAFLD + CAD	χ²	P1	χ²	P2
Genotype				0.873	0.646	4.807	0.094
CC	111	65	35
CT	109	58	56
TT	26	19	18
Allele				0.095	0.758	3.714	0.054
C	331	188	126
T	161	96	92
P1, NAFLD group vs Control group; P2, NAFLD + CAD vs NAFLD.

Table 4

Odds Ratios According to Genotypes of AGT rs2493132 Gene Polymorphism in Study Group
Genotype	Unadjusted				Adjusted^a
Genotype	OR (95% CI)	P1	OR (95% CI)	P2	OR (95% CI)	P1	OR (95% CI)	P2
Genotype
CC	1		1		1		1
CT + TT	0.974 (0.643–1.475)	0.901	1.785 (1.061–3.003)	0.029	0.748 (0.450–1.245)	0.264	4.718 (1.502–14.824)	0.008
Allele
C	1		1		1		1
T	1.050 (0.770–1.431)	0.758	1.430 (0.993–2.058)	0.054	0.882 ( 0.604–1.288)	0.516	2.436 (1.184–5.011)	0.016
P1, NAFLD group vs Control group; P2, NAFLD + CAD vs NAFLD.
^aBinary logistic regression model was used for the adjustment of age, gender, and body mass index.

Association of the AGT rs2493132 polymorphism with the clinical characteristics in the overall series

To investigate the effect of AGT rs2493132 polymorphism on the clinical parameters in the enrolled subjects, we compared the difference of clinical parameters of the AGT rs2493132 T allele carriers and non-carriers in the overall series. As the results shown in the Table 5, the serum levels of TC and LDL in the T allele carriers were higher than that of non-carriers (P = 0.045 and 0.044). There was no significant difference in other parameters such as ALT, AST, GGT, ALP, TG and HDL between the T allele carriers and non-carriers (all P > 0.05). The above results suggested that AGT rs2493132 T allele variant may increase the serum TC and LDL levels in the general population.

Table 5

Clinical Characteristics of AGT rs2493132 T allele Carriers and Non-carriers in the Overall Series
	Carriers	Non-carriers	P value
Male/Female	184/102	135/76	0.935
Age (y)	48.69 ± 11.62	47.33 ± 11.14	0.193
BMI (kg/m²)	26.16 ± 3.34	24.64 ± 3.12	0.083
ALT (U/L)	27.36 ± 24.15	28.16 ± 22.41	0.710
AST (U/L)	22.95 ± 10.18	22.79 ± 7.40	0.848
GGT (U/L)	29.92 ± 16.78	28.96 ± 16.13	0.536
ALP (U/L)	75.19 ± 20.29	72.37 ± 22.55	0.147
TG (mmol/L)	1.78 ± 1.92	1.81 ± 3.68	0.867
TC (mmol/L)	5.31 ± 1.54	5.06 ± 1.18	0.045
HDL (mmol/L)	1.21 ± 0.36	1.28 ± 0.53	0.108
LDL (mmol/L)	3.25 ± 1.51	3.03 ± 0.75	0.044
FPG (mmol/L)	5.42 ± 5.07	5.75 ± 7.85	0.584
SBP (mmHg)	124.89 ± 15.13	124.63 ± 16.41	0.876
DBP (mmHg)	82.39 ± 9.94	81.99 ± 10.63	0.707

NAFLD is a multisystem disease and tightly associated with the risk of CVD [22]. Previous studies proven that NAFLD is an independent risk factor for CAD, and CAD causes the majority death among NAFLD patients [22–24]. In a study conducted in Korea, Lee et al. showed that NAFLD was a independent predictor of CAD, and coronary artery stenosis was tightly correlated with fatty liver at the grade-dependent manner (P = 0.025) [25]. Accumulated studies had demonstrated that gene polymorphisms were the significant risk factor for the NAFLD and CAD. In the Chinese Han population, Liu et al. reported that genetic variants of TRIB1 rs17321515 could increase the risk of CAD in patients with NAFLD [26]. Cheng et al. showed that the TNF-α-238 gene polymorphism also increases the developing risk of CAD in NAFLD patients in Chinese Han population [27]. Moreover, variants in PNPLA3 and TM6SF2 predispose to NAFLD conferred a mild protective effect for CAD, and both TM6SF2 and PNPLA3 gene polymorphisms were associated with lower plasma lipid levels [3, 28]. These results suggested that gene polymorphisms play an important role in the development of CAD in patients with NAFLD, gene polymorphisms may exert the protective or risk dangerous role for the CAD in patients with NAFLD.

Previous study showed that the AGT M35T gene polymorphism was strongly associated with the increased risk of heart failure [29]. A study in Saudi Arabia reported that AGT variants (rs5051C and rs7079G) were related to CAD [30]. In the current study, we investigated the effect of AGT rs2493132 polymorphism on the risk of NAFLD in general population and the risk of CAD in patients with NAFLD for the first time. We found that the AGT rs2493132 CT + TT genotype was tightly associated with the developing risk of CAD in the NAFLD patients, but not the AGT rs2493132 T allele. After adjusted for the age, gender, and BMI, the association of AGT rs2493132 CT + TT genotype with the risk of CAD was remains exist. In addition, the AGT rs2493132 T allele also significant increases the developing risk of CAD in the patients with NAFLD after adjusted for gender, age, and BMI.

Dyslipidemia is a common feature of both NAFLD and CAD patients which characterized by the elevated plasma triacylglycerol, circulating LDL particles and the reduced HDL [31–34]. Brouwers et al. suggested that plasma lipids act as the major mediators in the relationship between NAFLD and CVD [3]. The characteristics of subjects in this study showed that NAFLD patients possess the higher levers of BMI, AST, ALT, TG, LDL, GGT, and decreased level of HDL compare to health controls, that is consistent with the changes of serum lipids profiles in patients with NAFLD in previous studies [32, 35–37]. In the overall series in this study, we found that AGT rs2493132 T allele carriers were likely to possess the higher serum TC and LDL levels compared to the non-carriers. Previous study suggested that the decreased LDL levels could protect the NAFLD patients from the cardiovascular disease, and the NAFLD susceptibility genes confer to the strong relationship between plasma lipids and the risk of CAD [38, 39]. These data suggested that AGT rs2493132 gene polymorphism may increase the risk of CAD in the NAFLD patients by affect the concentrations of serum TC and LDL levels.

There were several limitations in this study. Firstly, the diagnosis of NAFLD was conducted by ultrasonography rather than the liver biopsy due to the limited acceptability of liver biopsy in the clinical examination. Secondly, the CAD is usually occurred in the older peoples; therefore, the mean age in patients with NAFLD + CAD is higher than the NAFLD patients and the health controls. Thirdly, all the study subjects in the study were Han Chinese in Qingdao. Therefore, the role of AGT rs2493132 in the risk of NAFLD and CAD should be studied in other countries and ethnicity.

In summary, this study investigated the effect of AGT rs2493132 polymorphism on the risk of NAFLD and CAD in Chinese Han population. The results showed that AGT rs2493132 CT + TT genotype was tightly associated with the developing risk of CAD in the NAFLD patients. After adjusted for the age, gender, and BMI, AGT rs2493132 CT + TT genotype and T allele remain significantly increased the risk of CAD in patients with NAFLD. In addition, AGT rs2493132 T allele carriers possess the higher LDL and TC levels compared to the non-carriers in all the subjects. This is the first time to investigate the effect of AGT rs2493132 polymorphism on the developing risk of NAFLD and CAD, the role of AGT rs2493132 in the risk of NAFLD and CAD should be studied in other countries and ethnicity in the further studies.

AASLD, American association for the study of liver disease; AGT, Angiotensinogen; ALP, alkaline phosphatase; ALT, alanine aminotransferase; AST, aspartic aminotransferase; CI, confidence intervals; CAD, coronary artery disease; CVD, cardiovascular disease; FPG, fasting blood glucose; GCKR, Glucokinase regulatory protein gene; GGT, gamma-glutamine transpeptidase; HDL, high-density lipoprotein; LDL, low-density lipoprotein; NAFLD, Non-alcoholic fatty liver disease; OR, odds ratio; SD, standard deviation; TC, total cholesterol; TG, triglyceride

Availability of data and materials

All data generated or analyzed in this study are available from the corresponding author for the reasonable request.

Authors’ contributions

DMZ and ZJ, MXF, and LSS acquisition of data, analysis and interpretation of data, drafting the article, and final approval; DMZ, ZJ, MXF, WMK, and WYF, acquisition of data, analysis and interpretation of data. XYN and LSS design this study and revision of this article. All authors have read and approved the manuscript.

Consent for publication

All the authors consent for this publication.

Ethics approval and consent to participate

Not applicable.

Competing interests

The authors do not have any disclosures to report.

Funding

This study was supported by Grants of National Natural Science Foundation of China (31770837).

Acknowledgements

We thanks to Jie Tan for the assistance in this study.

Li J, Zou B, Yeo YH, Feng Y, Xie X, Lee DH, Fujii H, Wu Y, Kam LY, Ji F, et al. Prevalence, incidence, and outcome of non-alcoholic fatty liver disease in Asia, 1999–2019: a systematic review and meta-analysis. The lancet Gastroenterology hepatology. 2019;4(5):389–98.
Targher G, Byrne CD, Lonardo A, Zoppini G, Barbui C. Non-alcoholic fatty liver disease and risk of incident cardiovascular disease: A meta-analysis. Journal of hepatology. 2016;65(3):589–600.
Brouwers M, Simons N, Stehouwer CDA, Isaacs A. Non-alcoholic fatty liver disease and cardiovascular disease: assessing the evidence for causality. Diabetologia. 2020;63(2):253–60.
Athyros VG, Tziomalos K, Katsiki N, Doumas M, Karagiannis A, Mikhailidis DP. Cardiovascular risk across the histological spectrum and the clinical manifestations of non-alcoholic fatty liver disease: An update. World J Gastroenterol. 2015;21(22):6820–34.
Liu HH, Cao YX, Sun D, Jin JL, Guo YL, Wu NQ, Zhu CG, Gao Y, Dong QT, Zhao X, et al. Impact of Non-Alcoholic Fatty Liver Disease on Cardiovascular Outcomes in Patients With Stable Coronary Artery Disease: A Matched Case-Control Study. Clin Transl Gastroenterol. 2019;10(2):e00011.
Öztürk H, Gümrükçüoğlu HA, Yaman M, Akyol A, Öztürk Ş, Akdağ S, Şimşek H, Şahin M, Günaydın ZY. Hepatosteatosis and carotid intima-media thickness in patients with myocardial infarction. J Med Ultrason (2001). 2016;43(1):77–82.
Wojcik-Cichy K, Koslinska-Berkan E, Piekarska A. The influence of NAFLD on the risk of atherosclerosis and cardiovascular diseases. Clinical experimental hepatology. 2018;4(1):1–6.
Romeo S, Kozlitina J, Xing C, Pertsemlidis A, Cox D, Pennacchio LA, Boerwinkle E, Cohen JC, Hobbs HH. Genetic variation in PNPLA3 confers susceptibility to nonalcoholic fatty liver disease. Nat Genet. 2008;40(12):1461–5.
Simons N, Isaacs A, Koek GH, Kuč S, Schaper NC, Brouwers M. PNPLA3, TM6SF2, and MBOAT7 Genotypes and Coronary Artery Disease. Gastroenterology. 2017;152(4):912–3.
Brouwers M, Jacobs C, Bast A, Stehouwer CDA, Schaper NC. Modulation of Glucokinase Regulatory Protein: A Double-Edged Sword? Trends Mol Med. 2015;21(10):583–94.
Kitamoto A, Kitamoto T, Nakamura T, Ogawa Y, Yoneda M, Hyogo H, Ochi H, Mizusawa S, Ueno T, Nakao K, et al. Association of polymorphisms in GCKR and TRIB1 with nonalcoholic fatty liver disease and metabolic syndrome traits. Endocr J. 2014;61(7):683–9.
Simons P, Simons N, Stehouwer CDA, Schalkwijk CG, Schaper NC, Brouwers M. Association of common gene variants in glucokinase regulatory protein with cardiorenal disease: A systematic review and meta-analysis. PLoS One. 2018;13(10):e0206174.
Lu H, Cassis LA, Kooi CW, Daugherty A. Structure and functions of angiotensinogen. Hypertens Res. 2016;39(7):492–500.
Lu H, Wu C, Howatt DA, Balakrishnan A, Moorleghen JJ, Chen X, Zhao M, Graham MJ, Mullick AE, Crooke RM, et al. Angiotensinogen Exerts Effects Independent of Angiotensin II. Arterioscler Thromb Vasc Biol. 2016;36(2):256–65.
Almeida LF, Tofteng SS, Madsen K, Jensen BL. Role of the renin-angiotensin system in kidney development and programming of adult blood pressure. Clin Sci (Lond). 2020;134(6):641–56.
Tao XR, Rong JB, Lu HS, Daugherty A, Shi P, Ke CL, Zhang ZC, Xu YC, Wang JA. Angiotensinogen in hepatocytes contributes to Western diet-induced liver steatosis. J Lipid Res. 2019;60(12):1983–95.
Junusbekov Y, Bayoglu B, Cengiz M, Dirican A, Arslan C. AGT rs699 and AGTR1 rs5186 gene variants are associated with cardiovascular-related phenotypes in atherosclerotic peripheral arterial obstructive disease. Ir J Med Sci 2019.
Khamlaoui W, Mehri S, Hammami S, Elosua R, Hammami M. Association of angiotensin-converting enzyme insertion/deletion (ACE I/D) and angiotensinogen (AGT M235T) polymorphisms with the risk of obesity in a Tunisian population. J Renin Angiotensin Aldosterone Syst. 2020;21(2):1470320320907820.
Ji L, Cai X, Zhang L, Fei L, Wang L, Su J, Lazar L, Xu J, Zhang Y. Association between polymorphisms in the renin-angiotensin-aldosterone system genes and essential hypertension in the Han Chinese population. PLoS One. 2013;8(8):e72701.
Rickham PP. Human Experimentation. Code of Ethics of the World Medical Association. Declaration of Helsinki. Br Med J. 1964;2(5402):177.
Fan JG, Jia JD, Li YM, Wang BY, Lu LG, Shi JP, Chan LY, Chinese Association for the Study of Liver D: Guidelines for the diagnosis and management of nonalcoholic fatty liver disease: update 2010: (published in Chinese on Chinese Journal of Hepatology 2010; 18:163–166). J Dig Dis 2011, 12(1):38–44.
Byrne CD, Targher G. NAFLD: a multisystem disease. J Hepatol. 2015;62(1 Suppl):47–64.
Targher G, Byrne CD, Lonardo A, Zoppini G, Barbui C. Non-alcoholic fatty liver disease and risk of incident cardiovascular disease: A meta-analysis. Journal of hepatology. 2016;65(3):589–600.
Athyros VG, Tziomalos K, Katsiki N, Doumas M, Karagiannis A, Mikhailidis DP. Cardiovascular risk across the histological spectrum and the clinical manifestations of non-alcoholic fatty liver disease: An update. World journal of gastroenterology. 2015;21(22):6820–34.
Lee JE, Lee YJ, Chung SY, Cho HW, Park BJ, Jung DH. Severity of nonalcoholic fatty liver disease is associated with subclinical cerebro-cardiovascular atherosclerosis risk in Korean men. PLoS One. 2018;13(3):e0193191.
Liu Q, Liu SS, Zhao ZZ, Zhao BT, Du SX, Jin WW, Xin YN. TRIB1 rs17321515 gene polymorphism increases the risk of coronary heart disease in general population and non-alcoholic fatty liver disease patients in Chinese Han population. Lipids Health Dis. 2019;18(1):165.
Cheng Y, An B, Jiang M, Xin Y, Xuan S. Association of Tumor Necrosis Factor-alpha Polymorphisms and Risk of Coronary Artery Disease in Patients With Non-alcoholic Fatty Liver Disease. Hepat Mon. 2015;15(3):e26818.
Liu DJ, Peloso GM, Yu H, Butterworth AS, Wang X, Mahajan A, Saleheen D, Emdin C, Alam D, Alves AC, et al. Exome-wide association study of plasma lipids in > 300,000 individuals. Nat Genet. 2017;49(12):1758–66.
Chen S, Zhang L, Wang HW, Wang XY, Li XQ, Zhang LL. The M235T polymorphism in the angiotensinogen gene and heart failure: a meta-analysis. J Renin Angiotensin Aldosterone Syst. 2014;15(2):190–5.
Al-Najai M, Muiya P, Tahir AI, Elhawari S, Gueco D, Andres E, Mazhar N, Altassan N, Alshahid M, Dzimiri N. Association of the angiotensinogen gene polymorphism with atherosclerosis and its risk traits in the Saudi population. BMC Cardiovasc Disord. 2013;13:17.
Brouwers MC, Cantor RM, Kono N, Yoon JL, van der Kallen CJ, Bilderbeek-Beckers MA, van Greevenbroek MM, Lusis AJ, de Bruin TW. Heritability and genetic loci of fatty liver in familial combined hyperlipidemia. J Lipid Res. 2006;47(12):2799–807.
DeFilippis AP, Blaha MJ, Martin SS, Reed RM, Jones SR, Nasir K, Blumenthal RS, Budoff MJ. Nonalcoholic fatty liver disease and serum lipoproteins: the Multi-Ethnic Study of Atherosclerosis. Atherosclerosis. 2013;227(2):429–36.
Do R, Willer CJ, Schmidt EM, Sengupta S, Gao C, Peloso GM, Gustafsson S, Kanoni S, Ganna A, Chen J, et al. Common variants associated with plasma triglycerides and risk for coronary artery disease. Nat Genet. 2013;45(11):1345–52.
Chapman MJ, Guérin M, Bruckert E. Atherogenic, dense low-density lipoproteins. Pathophysiology and new therapeutic approaches. Eur Heart J 1998, 19 Suppl A:A24–30.
Mato JM, Alonso C, Noureddin M, Lu SC. Biomarkers and subtypes of deranged lipid metabolism in non-alcoholic fatty liver disease. World J Gastroenterol. 2019;25(24):3009–20.
Vilar CP, Cotrim HP, Florentino GS, Bragagnoli G, Schwingel PA, Barreto CP. Nonalcoholic fatty liver disease in patients with coronary disease from a Brazil northeast area. Arq Gastroenterol. 2015;52(2):111–6.
Liu H, Yao Y, Wang Y, Ma L, Liu X, Guo S, Feng X, Chen Y, Chen X, Liu Z, et al. Ideal cardiovascular health metrics and the risk of non-alcoholic fatty liver disease: A cross-sectional study in northern China. Liver international: official journal of the International Association for the Study of the Liver. 2019;39(5):950–5.
Dongiovanni P, Petta S, Maglio C, Fracanzani AL, Pipitone R, Mozzi E, Motta BM, Kaminska D, Rametta R, Grimaudo S, et al. Transmembrane 6 superfamily member 2 gene variant disentangles nonalcoholic steatohepatitis from cardiovascular disease. Hepatology. 2015;61(2):506–14.
Brouwers M, Simons N, Stehouwer CDA, Koek GH, Schaper NC, Isaacs A. Relationship Between Nonalcoholic Fatty Liver Disease Susceptibility Genes and Coronary Artery Disease. Hepatology communications. 2019;3(4):587–96.

Download PDF

Version 1

posted

You are reading this latest preprint version

Association of AGT rs2493132 Polymorphism and the Risk of Coronary Artery Disease in Patients with Non-alcoholic Fatty Liver Disease in Chinese Han Population

Status:

Version 1

Abstract

Background

Materials And Methods

Study subjects

Biochemical Analyses

Genomic Dna Extraction And Genotyping

Statistical analysis

Results

Clinical characteristics of the study population

Genotypes And Allele Distribution Of Agt Rs2493132

Discussion

Conclusions

Abbreviations

Declarations

References

Status:

Version 1