Cultivation and cell treatments of human neuroblastoma cell lines
The human SH-SY5Y neuroblastoma cell line was purchased from the European Collection of Authenticated Cell Cultures (ECACC) and used for the generation of our screening cell lines. All cell lines were cultivated in DMEM F12 Glutamax (Gibco) supplemented with 1 % penicillin/streptomycin (Gibco) and 10 % inactivated FBS (Merck), respectively. For detachment, cells were treated with 1 % Trypsin-EDTA for 10min at 37°C.
Generation of SNCA-GFP-LUC fusion cell line via CRISPR/Cas9 gene editing and homologous recombination.
CRISPR target sites for SNCA exon 6 were selected from the web tool chopchop (https://chopchop.cbu.uib.no/)[21, 22] using the genomic sequence of exon 6 of SNCA (NG_011851.1) and cloned into GeneArt® CRISPR Nuclease Vector Kit (Thermo Fisher Scientific) according to manufacturer’s protocol. Primers for SNCA_CRISPR target site 1 Exon 6 as follows: forward TGGGAGCAAAGATATTTCTTGTTTT, reverse AAGAAATATCTTTGCTCCCACGGTG.
For cloning of the homologous recombination (HR) vector HR150PA-1 (PrecisionX ™ HR Targeting Vectors, System Bioscience), primers for the HR arms were tagged with 5’ palindromic sequences for respective restriction enzymes (bold) and amplified with Herculase II Fusion DNA Polymerase (Agilent) from genomic DNA (gDNA) of SH-SY5Y. Primers were as follows: left HR arms upstream GFP-LUC cassette (HR150PA-1), forward GAATTCGACATTCTGGCACAAGGGAATATCAG and reverse GAATTCGGCTTCAGGTTCGTAGTCTTGATACC, EcoRI; for right HR arm downstream GFP-LUC cassette (HR150PA-1), forward GGATCCAATATCTTTGCTCCCAGTTTCTTGAG and reverse GTCGACGACAGGATTGAAGGGAGAAATAGACC, BamHI and SalI, respectively. Total length of HR arms were as follows: left HR arm 905 bp and right HR arm 889 bp. PCR products were sub-cloned into pJET1.2 (CloneJET PCR Cloning Kit, Thermo Fisher Scientific) and finally inserted into the HR150PA-1. Vector integrity was confirmed by sequencing. All restriction enzymes were fast digest enzymes and purchased from Fermentas, Thermo Fisher Scientific.
Transfection, selection and screening of the SNCA-GFP-LUC knock-in cell line
Transfection of the CRISPR/Cas9- and the HR-plasmids, were performed with the Roti®-Fect PLUS (Roth) transfection mix, according to manufacturer’s protocol. Selection pressure was applied after 24 h and maintained for 1–2 weeks. Single colonies were picked by using Corning® Cloning Cylinders according to manufacturer’s protocol Plates were duplicated when cells reached 80 % confluency and protein lysates were generated to screen clones via western blot.
Isolation of nucleic acids
Genomic DNA (gDNA)
Pelleted cells were incubated with 350 µl TENS buffer (50 mM TrisCl pH 8.0, 100 mM EDTA pH 8.0, 100 mM NaCl, 1% SDS) and 17.5 µl Proteinase K (10 mg/ml) overnight in a water bath at 55°C. At the next day, 150 µL NaCl solution (saturated in H2O) were added, samples were incubated on ice for 5 min and centrifuged for 30min. The supernatant was transferred into a fresh reaction tube, mixed with 500 µl isopropanol and incubated for 10 min at room temperature (RT). Samples were centrifuged for 30 min, supernatant was discarded and gDNA pellets were washed with 70 % ethanol followed by 15 min centrifugation. Air-dried DNA was resolved in 10 mM Tris pH 7.5. All centrifugation steps were carried out at 16000 rcf and 4°C (adapted from “The Jacks Lab: DNA Isolation from Tail-Proteinase K Method”).
PCR
Standard PCR and gel-electrophoreses
For the generation of the homologous recombination arms 100–200 ng DNA was amplified in a total volume of 20 µl. Mastermix was prepared at final concentrations of 1x reaction buffer (Genecraft®, BioTherm™), 250 µM dNTPs (Thermofisher Scientific), 0.2 µM of each primer, 1 unit Taq DNA polymerase (Genecraft®, BioTherm™) and filled up to 20 µl with H2O. After initial denaturation at 94°C for 3 min PCR were run for 30 cycles (denaturation 94°C for 30 sec, annealing for 30 sec at respective temperature, extension 68°C for 1 min). PCR products were amplified in the Biometra TADVANCED thermocycler and separated in 1 % TBE agarose gel containing 2.5x GelRed® Nucleic Acid Gel Stain (Biotium) for visualization. For the validation of SNCA-GFP-LUC-fusion, mRNA was converted into cDNA and amplified by using SNCAqF2 GGACCAGTTGGGCAAGAATG and HR150GFP reverse tgtcacgatcaaaggactctgg primer. As a negative control for the wildtype locus we used SNCAqF2 and the corresponding reverse primer SNCAqR2 GGCACATTGGAACTGAGCAC.
Miniprep/Maxipreparation
We used Top10F’ E. coli cells for transformation and mini-and maxi preparation ZR Plasmid Miniprep – Classic (Zymo) and the NucleoBond Xtra Maxi kit (Macherey-Nagel) were used, respectively.
RT-qPCR assays
LUC mRNA
Total RNA for initial RT-qPCR assays was isolated with the Qiagen FastLane Cell RT-PCR SYBR® Green Kit. Cells were seeded at a density of 8x104 in 50 µl/well and 96 well format and treated the next day at effective compound concentration of 25 µM and equivalent DMSO controls. Each plate contained 30 compounds in triplicates and six DMSO controls. Cells were lysed in a total volume of 50 µl cell processing mix in accordance to manufacturer’s protocol with the following adaptions: 1) prolonged incubation (10 min) of the processing mix and 2) additional incubation of the lysates at 75°C prior RT-qPCR (5 min). The RT-qPCR assays were performed with the QuantiTect SYBR® Green RT-PCR Kit (Qiagen) in 384 well format. We used 3 µl of the cell processing mix (total of 50 µl) for amplification. Reactions were run in a Roche LightCycler 480 system. Primers were as follows: LUC, forward GAACATCACGTACGCGGAAT and reverse GCGCAACTGCAACTCCGATA. LUC mRNA expression was normalized to ubiquitin C (UBC) and glucuronidase beta GUSB housekeeping genes.
SNCA mRNA
For hit validation SH-SY5Y wildtype cells were treated at effective concentrations of 25 µM (12.5 µM for clomiphene-citrate) for 24 h in 24 well plate format and triplicates. Total RNA was extracted with the RNeasy Mini kit (Qiagen). RT-qPCR reactions were performed with the QuantiTect SYBR® Green RT-PCR Kit (Qiagen) in a 96 well format and run in the Applied Biosystems™ HT7500 cycler. We used 50 ng of total RNA for amplification. Primers were as follows: SNCA, accession number NM_000345, purchased from Qiagen (Hs_SNCA_1_SG QuantiTect Primer Assay (QT00035903). SNCA mRNA expression was normalized to UBC, hypoxanthine phosphoribosyl-transferase 1 (HPRT1) and GUSB housekeeping genes.
Housekeeping primers were as follows: HPRT1, accession number NM_000194.3, forward TGACACTGGCAAAACAATGCA and reverse GGTCCTTTTCACCAGCAAGCT. UBC, accession number M26880, forward ATTTGGGTCGCGGTTCTTG and reverse TGCCTTGACATTCTCGATGGT [23]. GUSB, accession number XM_005250297.4, forward CCAGCGTGGAGCAAGACA and reverse CCATTCGCCACGACTTTGTT. Relative mRNA levels were calculated using the ΔΔCT Method for multiple housekeeping genes from Pfaffl, published in “A-Z of quantitative PCR” [24].
SDS PAGE and western blot analysis
For SDS-PAGE cells were harvested and lysed in RIPA buffer (50 mM TrisCl pH 7.5, 150 mM NaCl, 10 mM MgCl2, 0.5 % Triton x100) supplemented with Thermo Scientific™ Halt™ Protease Inhibitor-Cocktail (1x final concentration) and 0.5 µl/ml benzonase (Merck) for 30 min on ice. Lysates were mixed with 4x Laemmli loading buffer (200 mM TrisCl pH 6.8, 8 % SDS, 6 % β-mercapto-ethanol, 33 % glycerol, spatula tip bromophenol blue) to a final concentration of 1x and boiled for 10 min at 95°C. Samples were loaded onto 15 % SDS-PAGE gels.
Nuclear extraction for histone Western blots
Nuclear extraction was performed according to Schreiber et al., (1989) with the following adaptions: Buffer C was supplemented with 0.1 % SDS. Buffer A and C were supplemented with Thermo Scientific™ Halt™ Protease Inhibitor-Cocktail 1x final concentration. We used 200 µl of buffer A and 60 µl of buffer (12-well plate format). Nuclei were sonicated for three seconds and three intervals at 50 % power (Bandelin Sonopuls, HD2070, SH70G, type MS72), incubated on ice for 30 min and clarified by centrifugation. Supernatants were transferred to fresh tubes and stored at -80°C. All centrifugation steps were carried out for 10 min at 16000 rcf and 4°C.
Western blot
Proteins were blotted onto methanol activated polyvinylidene difluoride (PVDF) membrane (GE Healthcare, Amersham™ Hybond™), blocked with 5 % milk-powder (Roth) in 1xPBS-TWEEN® 20 0.1 % (PBST 0.1 %) for 1h and incubated with SNCA 2F12 (1:2000, MABN1817, Fisher Scientific) and beta actin (1:10000, A5441, Sigma) primary antibodies overnight at 4°C. Secondary HRP conjugated anti mouse antibody (1:4000, P0447, Dako) was applied for 1 h at room temperature. For histone H3 and H4 global acetylation (# 06-599 and # 06-598, Millipore) and H3K4 tri-methylation (C42D8, Cell Signaling) were used. For normalization of nuclear extracts, we used the Lamin B1 antibody (D4Q4Z, Cell Signaling). Secondary HRP conjugated anti rabbit antibody (1:4000, 7074V, Cell Signaling) was applied.
Membranes were washed three times with PBST 0.1 % (1xTBS- TWEEN® 20 0.1 % for histone Western blots) and imaged with enhanced chemiluminescence (ECL) in the ChemoCam imager (Intas).
For SNCA and beta actin the secondary IRDye® 800CW Donkey anti-Mouse IgG antibody (1:4000, LI-COR) was applied for 1 h at room temperature (in the dark). Membranes were imaged with the LI-COR Odysseys Clx. Signals were quantified using Image Studio 4.0 software. Treated cells were normalized to actin and DMSO control, respectively.
In-Cell Western
For In-Cell Western (ICW) experiments, cells were plated in 96 well plates (black/clear, Falcon) at a density of 8x104 cells/well. Cells were treated at the next day. After treatment, media were discarded and cells were fixed with 100 µl ice cold 100 % methanol (-20°C) for 15 min at RT on an orbital shaker. Methanol was discarded, permeabilized cells were washed with 100 µl 1xPBS and blocked with 0.5 % casein blocking solution (Casein diluted in 1x PBS) for 30 min at RT. After blocking, cells were incubated with 50 µl of alpha synuclein 2F12 primary antibody dilution (diluted 1:2000 in 0.5 % casein PBS + 0.1 % blocking solution (PBST)) at 4°C on an orbital shaker overnight. On the next day, cells were washed 3x with 100 µl 1xPBST and incubated with 50 µl of CellTag™ 700 Stain (1:1000 from LI-COR) and secondary IRDye® 800CW Donkey anti-Mouse IgG antibody (1:1000, from LI-COR) in 0.5 % casein PBST blocking solution for 1 h at RT on an orbital shaker. Plates were protected from light. Cells were washed 3x with 100 µl PBST and 1x with PBS and imaged with the LI-COR Odyssey Clx.
For analysis the Image Studio 4.0 software (provided from LI-COR) was used and signals were normalized to CellTag700 and DMSO, respectively. As a background control, cells were incubated with secondary antibody and CellTag700 alone.
LUC assay
Bioactive compound collections (SelleckChem) were randomly spotted – initially at a concentration of 10 µM in three independent experiments. We used valproic acid (VPA), a known modulator of α-syn expression, as a positive control (Fig. 2A).
The screening process was fully automated. For the luciferase assay 2x104 cells/well in a volume of 30 µl were seeded into nunc white 384 well plates (Thermo scientific). Cells attached and grew for approx. 18 h at 37°C before treatment. The pre-spotted 384 well compound plates (100 nl/well) were diluted with 25 µl medium/well and shaken for 5 min with 1200 rpm at RT. Subsequently, 10 µl of the compound dilution were applied to 384 well cell plates, resulting in a final concentration of 10 µM and incubated for 24 h at 37°C. Controls were distributed on the assay plate in a fixed layout for all three independent experiments. The tested drugs were randomly distributed for the three experiments to avoid well location dependent effects (Fig. 2A). Cells were lysed by adding 40 µl of ONE Glo (Lysis Buffer and Luciferase Substrate, Promega) to each well (on top of medium), incubated for 5 min while shaking at 1200 rpm and luciferase signal was measured with the Paradigm Reader at 1200 ms integration time.
For hit definition the LUC signal of treated cells was normalized to untreated controls per plate. Compounds showing an increased (activators) or decreased (inhibitors) LUC signal of more than the four-fold standard deviation of the mean (SD) of untreated controls were considered as effective modulators (Fig. 2B).
Repeated experiments were conducted in Nunc white 96 well plates and measured with the Centro LB 960 (Berthold Technologies) at 1200 ms integration time.
Cell viability tests
To screen for potentially cytotoxic effects we performed a combination of a homogenous resazurine test and an image-based high content screen (HCS) on single cell level in a dose range of 0.25 µM-40 µM, respectively. The resazurine assay was performed according to manufacturer’s protocol. For the HCS, the nuclei of treated cells were stained with the fluorescent DNA probe DRAQ5™. After imaging, living and dead cells were counted per well and total cell viability were calculated for each well and applied compound concentration.
Statistics
We used one-way ANOVA (α = 0.05) followed by the recommended Dunnett’s multiple comparison test to check for statistical significance. All statistical analyses were performed in GraphPad Prism 7.02.