Animal preparation
Adult male Sprague–Dawley rats (250–300 g) were purchased from the Animal Center of the School of Medicine, Yangzhou University. The rats were housed in air-filtered rooms and were given ad libitum access to food and water. Animals were housed at a constant temperature (20–24 °C) and constant humidity (50–70%) with a 12/12-h light/dark cycle. The study protocol was approved by the Animal Care and Use Committee of Yangzhou University (Yangzhou, China) and was in accordance with the guidelines for the care and use of animals set by the Chinese government.
Experimental procedure and animal model of VILI
Lung injury was induced in the rats using high tidal volume mechanical ventilation (HVMV), based on a previously published VILI model [13]. Briefly, all animals were anesthetized via an intraperitoneal injection of pentobarbital sodium (40 mg/kg, Merck, Darmstadt, Germany). After induction of anesthesia, the rats underwent an oral endotracheal intubation with a 16 G trocar and were ventilated for hours in a volume-controlled ventilation mode (DW 3000, Zhenghua Biologic, Anhui Province, China). Animals were ventilated with a high tidal volume (Vt) of 22 ml/kg and zero positive end-expiratory pressure (PEEP) at a respiratory rate of 16–18 breaths/min, whereas control (sham) rats were ventilated with a Vt of 6 ml/kg and PEEP of 5 cm H2O at a rate of 45–55 breaths/min. The fraction of inspired oxygen (FiO2) remained constant at 0.21. The rats were placed in the supine position on a heating blanket and under a heating lamp, to ensure a body temperature of 37 °C throughout the experiment. A polyethylene catheter was placed in the femoral artery to monitor mean arterial pressure and heart rate, as well as for blood sampling. The arterial catheter was infused with physiological saline at 0.5 mL/h and anesthesia was maintained by additional injections (15 mg/kg, i.p.) administered every hour under hemodynamic monitoring. After mechanical ventilation, the rats were returned to their cages and provided food and water ad libitum. 10 μg of GsMTx4 (dissolved in 0.2 mL of saline) or vehicle was injected via arterial supply of the hindlimb for thirty minutes before the VILI procedure. Rats were killed by heart bloodletting 6 h after administration of ventilation.
Cell culture and transfection
The human alveolar epithelial cell line (A549) and the human pulmonary microvascular endothelial cell line (HPMEC) were purchased from the BNCC Biotechnology Research Institute (Beijing, China). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM)and M199 (HyClone, Logan, UT, USA) supplemented with 10% fetal bovine serum (Gibco, Carlsbad, CA, USA), 100 U/ml penicillin, and 100 μg/ml streptomycin at 37 °C in an atmosphere of 95% air and 5% CO2. When the cells reached 80% confluence, they were seeded into 24-well or 6-well plates for further experiments. For small interfering RNA (siRNA) transfection, the Piezo1 siRNA (Thermo Fisher Scientific, Waltham, MA, USA) and its negative control siRNA (Invitrogen) were transfected into the cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Three days later, the cells were collected. HPMEC monolayers were pre-treated with different concentration of Yoda-1 (Tocris/BioTechne, Bristol, UK), 5 μM GSMTx4, 10 μM Y-27632 or fasudil (Merck Millipore, Burlington, MA, USA) for 24 h before cell deformation or collection.
Cell deformation
Cell deformation was achieved by stretching with a Flexercell Tension Plusä FX-4000T system (Flexcell International, Burlington, NC, USA) equipped with a loading station, which was designed to provide uniform strain to the cultured cells. The vacuum pressure was controlled by the computer, allowing cell monolayers to receive different levels of elongation. These deformations were selected as previously described [14]. Briefly, cells were seeded at 2.0 × 105 cells/cm2 on type I collagen-coated flexible bottom BioFlex plates (Flexcell international) and allowed to reach 50% confluence after 24 h. Then, the culture medium was changed to serum-deprived medium in each plate and the experimental plates with monolayer cell were mounted onto the Flexcell system. Cells were then exposed to cyclic stretch (CS) of high magnitude (20% elongation) for different durations (0–6 h) with a frequency of 15 cycles/min.
Flow cytometric analysis of cell apoptosis
To investigate the time-dependent effects of CS on cell apoptosis, the cells after CS exposures were stained with FITC-conjugated Annexin V and propidium iodide (PI) following manufacturer’s instructions (KeyGEN Biotech Co. Ltd, China) and was analyzed by flow cytometry (Beckman Coulter Co, USA).
Determination of water content and histological examination
To evaluate the severity of lung injury, ventilator-induced pulmonary edema was assessed based on the wet-to-dry weight ratio of the lung. The right upper lobe of each lung was weighed immediately after extraction and placed in a 60 °C oven for 72 h. The dried tissue was then weighed to determine the wet-to-dry weight ratio. Samples from the inferior lobe of the right lung were fixed in 4% paraformaldehyde solution, dehydrated sequentially in 50% to 100% alcohol, and treated with xylene solution. Then, the tissues were embedded in paraffin, sectioned (thickness, 6 μm), and stained with hematoxylin and eosin (H&E). The samples were assigned an injury score for each of these four categories: Alveolar and interstitial edema, microhemorrhage, inflammatory infiltration, and microatelectasis or alveolar overdistension. The injury scores were assigned as follows: 0, absent with normal appearance; 1, slight; 2, intermediate; and 3, severe [9, 15, 16]. The lung injury score was calculated by adding the individual injury scores for each category. The scoring was performed by a pathologist who was blinded to the data, using a light microscope (×40, Olympus, Tokyo, Japan) to view the stained tissue samples.
Protein leakage from capillaries
Pulmonary microvascular permeability was determined using the Evans blue dye extravasation method at 6 h after MV. Evans blue dye (30 mg/kg, Sigma-Aldrich, St. Louis, MO, USA) was administered intravenously at 30 min before the rats were sacrificed. Lungs were perfused to remove blood and extracted. The dye content in lung the tissue was determined spectrophotometry at an optical density of 620 nm [17].
Immunofluorescence
After animals were deeply anesthetized with pentobarbital sodium, they were perfused with 100–300 ml of 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4). The lung was harvested and post-fixed at 4 ℃ for 24 h. The lung tissues were embedded in Tissue-Tek (optimal cutting temperature (OCT) compound; SAKURA Finetek, Tokyo, Japan) and frozen in liquid nitrogen for the preparation of cryosections. Frozen lung tissues were cut to a thickness of 20 μm. After being blocked with phosphate-buffered saline (PBS) containing 10% goat serum and 0.3% Triton X-100 for 1–2 h at 37 ℃, the sections were incubated overnight at 4 ℃ with rabbit anti-Piezo1 (1:300, ProteinTech Group, Rosemont, IL, USA). The sections were then incubated with goat anti-rabbit IgG conjugated with Cy3 (1:500, Jackson ImmunoResearch, West Grove, PA, USA) for 1 h at room temperature. The sections were finally mounted using Vectashield plus 4', 6-diamidino-2-phenylindole (DAPI) mounting medium (Vector Laboratories, Burlingame, CA, USA). HPMEC cells were fixed in 4% paraformaldehyde, and then incubated with anti-Piezo1 antibody (1:400) overnight at 4 °C. After washing five times with PBS, the cells were incubated with Cy3 (1:500) for 1 h at room temperature. Then, the cells were washed with PBS again five times for 1 h before being stained using DAPI for 2 min. After three further washes, the dishes were observed under a fluorescence microscope. All images were observed using a Leica DMI4000 fluorescence microscope and captured with a DFC365FX camera (Leica, Wetzlar, Germany).
Enzyme-linked immunosorbent assay
Bronchoalveolar lavage fluid (BALF) was collected and centrifuged at 6 h after MV was performed. The concentrations of tumor necrosis factor alpha (TNF-α), interleukin (IL)-1β, IL-6, and monocyte chemotactic protein 1 (MCP-1) were measured using a commercially available enzyme-linked immunosorbent assay (ELISA) kit according to the manufacturer’s instructions (R&D Systems, Minneapolis, MN, USA).
Western blottinganalysis
Lung tissues were homogenized and the cultured cells ultrasonicated in chilled lysis buffer (10 mM Tris, 1 mM phenylmethylsulfonyl fluoride, 5 mM MgCl2, 5 mM EGTA, 1 mM EDTA, 1 mM DTT, 40 μM leupeptin, 250 mM sucrose). Approximately 10% of the homogenates (by volume) were used to determine total protein levels. The remained was centrifuged at 4 °C for 15 min at 1000 ´ g. The supernatant was collected as cytosolic proteins. After the concentrations of the proteins were measured using a Bio-Rad protein assay (Bio-Rad, Hercules, CA, USA), equal amounts of total proteins were heated at 99 °C for 5 min and loaded onto a 4–15% stacking/7.5% separating SDS‑polyacrylamide gel (Bio-Rad). The proteins were then electrophoretically transferred onto a polyvinylidene difluoride membrane (Bio-Rad). The membrane was blocked for 2 h at room temperature, and then incubated at 4 °C overnight with the following primary antibodies: rabbit anti-synaptotagmin binding cytoplasmic RNA interacting protein (Syncrip) (1:1000; ProteinTech Group), rabbit anti-RhoA (1:5000; Abcam, Cambridge, MA, USA), rabbit anti-ROCK1 (1:1000; Abcam), and rabbit anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:2000; Sigma). The proteins were detected using horseradish peroxidase-conjugated anti-rabbit secondary antibody (1:3000; Jackson ImmunoResearch), and exposed using the ChemiDoc XRS System with Image Lab software (Bio-Rad). The intensity of immunoreactive protein bands was quantified using densitometry with the Image Lab software (Bio-Rad).
RhoA activity assay
Active GTP-bound RhoA was detected in lysates collected from cells subjected to a pull‑down assay using a RhoA activation assay kit (Abcam) according to manufacturer’s indications. Briefly, supernatants were incubated with an anti-active RhoA Rabbit monoclonal antibody and protein A/G Agarose bead slurry at 4 °C (×1 h) on a rotator. Bead-precipitated proteins were fractionated and immunoblotted using antibodies against RhoA.
Quantitative real-time reverse transcription-PCR
Lung tissues and cells were collected rapidly and pooled together to achieve sufficient RNA. Total RNA was extracted using a miRNeasy kit (Qiagen, Valencia, CA, USA) according to manufacturer’s instructions. Reverse-transcription to cDNA was achieved using ThermoScript Reverse Transcriptase (Invitrogen/Thermo Fisher Scientific) with oligo (dT) primers (Invitrogen/Thermo Fisher Scientific). The cDNA was then used in a quantitative real-time PCR amplification consisting of 30 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C for 40 cycles. Tubulin was used as an internal control. Relative changes of mRNA levels were calculated by using the △Ct method (2−△△Ct). The primers used in this study were as follows:
Piezo1 Forward: 5’- GGACTCTCGCTGGTCTACCT-3’;
Piezo1 Reverse: 5’- GGGCACAATATGCAGGCAGA -3’;
ROCK1 Forward: 5’- GACTGGGGACAGTTTTGAGAC-3’;
ROCK1 Reverse: 5’- GGGCATCCAATCCATCCAGC-3’;
Tubulin Forward: 5’-GCCTTCTGAGAGAGTTAAG-3’;
Tubulin Reverse: 5’-AGACTGGACCACCGGAGA-3’.
Survival curves
To observe the effect of Piezo1 on survival, 40 rats were randomly divided into four experimental groups as described earlier (n = 10 per group). Survival was assessed every day until the endpoint of 7 days. Survival data were analyzed using log-rank or χ2 tests. A p-value of less than 0.05 was considered statistically significant.
Statistical analyses
All data are presented as the mean ± SEM. The data were analyzed statistically using two-tailed, unpaired Student’s t tests and a one-way or two-way analysis of variance (ANOVA). When ANOVA showed a significant difference, pairwise comparisons between means were tested using the post hoc Tukey method (Sigma-Aldrich, Plot 12.5). P < 0.05 was considered statistically significant in all analyses.