Materials and buffers
Bovine knees were obtained from the local abattoir (Harald Hansens Eftf. I/S, Denmark). Biopsy punchers were purchased from Scandidact (cat#MTP-33-32). Dulbecco’s Modified Eagle medium (DMEM)/F12-GlutaMAX™ purchased from Thermo Fisher (cat#31331-093), together with Penicillin and Streptomycin (P/S) (cat#4333). The cytokines OSM (cat#O9635, Sigma-Aldrich), TNFα (R&D Systems, cat#210-TA), IL-17A (R&D Systems, cat#7955-IL) were reconstituted in 0.1 % bovine serum albumin (BSA) and further diluted in culture medium. All chemicals were purchased from Sigma-Aldrich or Merck unless stated otherwise.
Full-depth bovine articular cartilage explant tissue culture
Intact healthy stifle joints (i.e. with no perforation of the synovial capsule) from <2-year-old cattle were used within 48 hours after slaughter. After dissection and exposing the articular cartilage under sterile conditions, full-depth, 3 mm-in-diameter bovine cartilage explants (BEX) were punched out from the medial and lateral condyle and released from the subchondral bone with a sharp scalpel. One explant per well were placed in 96-well plates and washed five times in explant culture medium (DMEM+Glutamax/F12 (1:1) + 1 % Penicillin + 1 % Streptomycin). Plates were pre-incubated overnight at 37°C, 5 % CO2, ambient oxygen level for explants to equilibrate. Next day, explant metabolic activity was assessed using the alamarBlue (resazurin) metabolic assay (37) and fresh media containing treatments (10 ng/ml OSM in combination with 20 ng/ml TNFα; 100 ng/ml IL-17A; 25 ng/ml IL-17A or media without any treatment were added to an equal number of explants. Previous explant studies have used IL-17 levels in the range of 0.4-100 ng/ml (38-40). Based on preliminary cartilage explant experiments assessing collagenolytic activity in response to IL-17A (Supplementary figure 1), we selected our upper level to be 100ng/ml with the additional dose of 25ng/ml for comparison in our model. Both these concentrations are higher than reported physiological levels in serum and synovial fluid. However, in order to keep the experiments within a reasonable time frame this compromise was made in this exploratory study. Explants, with or without stimuli, were cultured at 37°C, 5 % CO2, ambient oxygen level for 21 days with media changes and conditioned media harvests performed three times a week, and metabolic activity assessed every seven days. Conditioned media from two animals (six technical replicates – explants – per condition, per animal) were selected for biomarker analysis. For proteomics analysis, conditioned media from additional two animals (two technical replicates – explants – per condition, per animal) were used.
Explant metabolic activity assessment using alamarBlue assay
Two hundred μl of 10 % alamarBlue (Thermo Fisher Scientific, cat#DAL1100) in BEX culture media solution was added to each well containing an explant and 4 empty wells for background. The 96-well plates were incubated for 3 hours at 37°C, 5 % CO2, after which 160 μl of alamar media was transferred to a black 96-well plate and read in a fluorimeter (Ex: 540 nm, Em: 590 nm, SpectraMax M5, Molecular Devices). The metabolic activity was measured in a total of 24 explants per each treatment group: 6 explants for each treatment group per animal; tissue from 4 animals.
PCR for IL-17R expression verification
Healthy, full-depth bovine femoral condyle articular cartilage (2.5 g) from two individual animals was snap-frozen and pulverized using a mortar and pestle in liquid nitrogen. Total RNA was extracted using RNAqueous Micro Kit (Thermo Fisher Scientific, cat#AM1912) according to the manufacturer’s instructions. Briefly, 4 ml of Lysis/Binding solution was added to 400 mg of pulverized cartilage and the lysate was homogenized using a rotor-stator homogenizer and centrifuged to 3 min at 16,000 x g to remove debris. The supernatant was mixed thoroughly with an equal volume of 64 % ethanol and loaded onto Filter Cartridges (700 μl per cartridge). After washing, RNA from each cartridge was eluted using 40 μl + 10 μl of the kit’s elution solution. The eluates were combined, and the RNA amount was spectrophotometrically determined (Nanodrop2000, Thermo Fisher Scientific). cDNA synthesis was performed with the Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Thermo Fisher Scientific, cat#K1641), using 50 ng total RNA in a total volume of 20 μl and incubated at: 25°C (10 min), 50°C (15 min) and 85°C (5 min). IL-17 receptor amplification was performed using Dream Taq Green PCR kit, with 0.5 ng (assuming 1:1 conversion from RNA) template cDNA and 200 nM (each) primers for IL-17RA (bIL17RA_f1: GCCCATTCCCAGGAGCTAAA, bIL-17RA_r1: CCACTGACCAAGACCACACA, product size: 459 bp), IL-17RB (bIL17RB_f1: ATCACCTTGGCTGCACATCA, bIL-17RB_r1: AAAACGTCCATTTGCCACCA, product size: 444 bp), IL-17RC (bIL17RC_f2: TCTCTGGGATGGTGACGTGC, bIL-17RC_r2: AGGATCTTCCCAGTACCCCT, product size: 178 bp), IL-17RD (bIL17RD_f1: TAAAACCAGTGCATTCCCCGT, bIL-17RD_r1: ACCCATTCTCTCTGCCGTTC, product size: 364 or 433 bp), or IL-17RE (bIL17RE_f1: GGAGCCACACTGTAGACCTG, bIL-17RE_r1: ACATACCACCCCTCTGACTCT, product size: 307 bp). The amplification was performed in a SimpliAmp PCR apparatus (Applied Biosystems) and the cycle conditions were: 95°C (3 min), 40 cycles of 95°C (30 s), 55°C (30 s), 72°C (1 min), followed by 72°C (10 min). The PCR products were separated on a 2% agarose gel (containing ethidium bromide) by electrophoresis and visualized by UV light in a ChemiDoc MP System (BioRad). PCR product bands were detected, and size estimated by ImageLab 6.0.1 software (BioRad). The gel image was exported as a TIFF file, cropped and annotated using Affinity Design 1.7.
Sulfated glycosaminoglycan (GAG) release measurement using a DMMB assay
The 1,9-dimethylmethylene blue (DMMB, Sigma-Aldrich, cat#341088) assay with chondroitin sulfate (Sigma, cat#C9819) as standard was used to measure the concentration of released GAGs from the cartilage explants in the culture medium (41, 42). The GAG content was determined by adding 250 μl DMMB solution (0.05 mM DMMB, 41 mM NaCl, 45 mM glycine and pH = 3.0) to 20 μl supernatant sample in a 96-well plate and immediately measuring the colorimetric change using a plate reader (SpectraMax M5, Molecular Devices) at 570 nm.
Histological analysis
To visualize proteoglycans in the tissue, cartilage explants were fixed on the last day of culture using 4 % phosphate-buffered formalin (pH 7.0), dehydrated with an automated tissue-processing apparatus (Sakura Tissue Tek VIP 5) and embedded in paraffin. The embedded tissue was cut to 5-micron thickness with the microtome knife angled at 9-10 degrees. The sections were collected on Superfrost+ glass slides (Thermo Scientific, cat# J1800AMNT), stained with safranin O/fast green (Brunschwig Chemie) and mounted with Eukitt mounting medium (Sigma-Aldrich, cat# 03989). The slides were analyzed on a Zeiss Axioplan-2 imaging system (Carl Zeiss). The samples were viewed through a 10x objective and images captured with an AxioCam HR camera using AxioVision 4.2 (Carl Zeiss) software.
Gelatin zymography
Pre-cast Novex™ Zymogram Plus Gels (Thermo Fisher Scientific, cat#ZY00100BOX), 10X Tris-Glycine SDS Running Buffer (Thermo Fisher Scientific, cat#LC2675), 10X Novex™ Zymogram Renaturing Buffer (Thermo Fisher Scientific, cat#LC2670) and 10X Novex™ Zymogram Developing Buffer (Thermo Fisher Scientific, cat#LC2671) and the XCell SureLock Mini-Cell (Thermo Fisher Scientific) gel running system was used for gelatin zymography, following the manufacturer’s instructions. Briefly, 15 μl of sample was diluted 1:1 in 2X Tris-Glycine SDS Sample Buffer. 20 μl of samples were loaded onto the 1.0 mm, 10-well gelatin gel, immersed in 1X Tris-Glycine SDS Running Buffer and run for 105 minutes at constant 125 V. The gel was renatured and equilibrated as recommended and developed in 1X Zymogram Developing Buffer at 37°C for 24 hours. The gel was stained with SimplyBlue Safestain (Thermo Fisher Scientific, cat#LC6060) using the high-sensitivity protocol.
Western blotting
Pooled conditioned media (from days 10, 14, 19 and 21) was diluted in NuPAGE 4X LDS Sample Buffer (Thermo Fisher Scientific, cat#NP0007), heated at 70°C for 10 minutes, then 20 µl was loaded onto a pre-cast NuPAGE 4-12% Bis-Tris 1.0 mm mini gel (Thermo Fisher Scientific, cat#NP0321BOX). The gel was run at 50V for 30 minutes followed by 70 V for 1.5 hour in 1X MES SDS buffer (Thermo Fisher Scientific, cat#NP0002). The protein transfer to nitrocellulose membrane was performed using P3 program on iBlot 2 Dry Blotting System (Thermo Fisher Scientific) according to manufacturer’s instructions. After blocking non-specific binding for 1 hour at room temperature with 5% BSA in Tris-buffered saline, 0.1% Tween 20 (TBST), the membrane was incubated with primary antibody against CHI3L1 (1:500, rabbit anti-human CHI3L1, Abcam, cat#ab180569) in 5% BSA TBST. After washing, the membrane was incubated with secondary antibody (1:50000, Jackson ImmunoResearch, cat#111-035-003) in 5% BSA TBST for 1 hour at room temperature. Signals were visualized with SuperSignal West Femto chemiluminescence kit (Thermo Fisher Scientific, cat#34094) on ChemiDoc MP System (BioRad). The blot image was exported as a TIFF file, cropped and annotated using Affinity Design 1.7.
Cartilage degradation biomarker measurements
Cartilage degradation was measured using three protein neo-epitope biomarker enzyme-linked immunosorbent assays (ELISAs): C2M (Nordic Bioscience, cat#1100), C3M (Nordic Bioscience, cat#1200) and exAGNx1 (Nordic Bioscience, in-house kit), using a method described previously (43-45). Briefly, 96-well streptavidin-coated microtiter plates were coated for 30 minutes at 20°C with the respective biotin-labelled neo-epitope peptides. Unbound peptide was washed off and 20 μL samples/standards were added, followed by 100 μl/well of peroxidase-labeled (C2M, C3M) or unlabeled (exAGNx1) monoclonal antibody in an assay-specific buffer. The plates were incubated either overnight at 4°C (C2M), for 3 hours (exAGNx1) at 20°C, or for 1 hour (C3M) at 20°C. ExAGNx1 was additionally incubated for 1 hour with a secondary anti-mouse horseradish peroxidase (HRP) labelled antibody after the 3-hour incubation with the primary antibody. The plates were washed and developed using 3,3',5,5'-Tetramethylbenzidine (TMB) and the reaction was stopped with sulfuric acid after 15 minutes. All assays were read on a standard plate reader (SpectraMax M5, Molecular Devices) at 450 nm with reference at 650 nm and calibration curves were plotted using a four-parametric mathematical fit model.
Sample processing and mass spectrometry for analysis of protein release from articular cartilage
Fifty μl of conditioned culture medium from different time points (days 10, 14, 19 and 21 of culture) was reduced by 4 mM dithiothreitol for 30 min at 56 °C, alkylated by 16 mM iodoacetamide for 60 min in the dark at room temperature, precipitated with ethanol and digested by 0.25 μg trypsin gold (Promega, cat#V5280) in 100 μl 0.1 M ammonium bicarbonate (AMBIC) buffer pH 7.8 for 16 hours on a shaker at 37 °C. After addition of 100 μl 1 M NaCl with 1% formic acid to the digests, these were run through 30 kDa filters (PALL Life Sciences, cat#OD030C34) to remove GAGs and desalted with reversed-phase Vydac UltraMicro Spin C18 columns (Harvard Apparatus, cat#74-7206) according to the manufacturer's instructions. Non-targeted mass spectrometry analysis was performed on a quadrupole Orbitrap benchtop mass spectrometer, QExactive, (Thermo Scientific) equipped with an Easy nano-LC 1000 system (ThermoFisher Scientific). Separation was performed on 75 μm × 25 cm, Acclaim Pepmap™ RSLC C18 capillary columns packed with 2 μm particles (ThermoFisher Scientific). A spray voltage of + 2000 V was used with a heated ion transfer setting of 275 °C for desolvation. The on-line reversed-phase separation was performed using a flow rate of 300 nl/min and a linear binary gradient 85 min was used. The gradient started with 3% solvent B for 4 min, then going to 35% solvent B in 64 min, after which it goes to 45% solvent B in 5 min. Finally, the organic solvent concentration was increased up to 90% in 5 min and kept at 90% for 7 min. An MS scan (400–1200 m/z) was recorded in the Orbitrap mass analyzer set at a resolution of 70,000 at 200 m/z, 1 × 106 automatic gain control (AGC) target and 100 ms maximum ion injection time (46). The MS was followed by data-dependent collision-induced dissociation MS/MS scans at a resolution of 17,500 on the 15 most intense multiply charged ions at 2 × 104 intensity threshold, 2 m/z isolation width and dynamic exclusion enabled for 30 s.
MS data analysis
Identification from discovery data was performed using the Bos taurus proteome (UniProt proteome ID UP000009136, n23868, downloaded 08/06/2015) with Proteome Discoverer 2.3 software (ThermoFisher Scientific). The processing workflow consisted of the following nodes: Spectrum Selector for spectra pre-processing (precursor mass range: 350–5000 Da; S/N Threshold: 1.5), Sequest-HT search engine (Protein Database: see above; Enzyme: Trypsin; Max. missed cleavage sites: 2; Peptide length range 6–144 amino acids; Precursor mass tolerance: 10 ppm; Fragment mass tolerance: 0.02 Da; Static modification: cysteine carbamidomethylation; and Percolator for peptide validation (FDR < 1% based on peptide q-value). Results were filtered to keep only the Master protein with at least one unique peptide, and protein grouping was allowed according to the parsimony principle. For label-free quantification (LFQ), the sum of the top 3 peptides for each protein was taken to reflect the intensity of the protein. Peptide intensities were quantified using a proprietary algorithm developed in Proteome Discoverer 2.3 (ThermoFisher Scientific).
Statistical analysis and data visualization
Biomarker measurements below Lower Limit of Measurement Range (LLMR) were imputed as the LLMR of the individual biomarker. Biomarker measurements above Upper Limit of Measurement Range (ULMR) were imputed as the ULMR of the individual biomarker and not re-measured due low remaining sample volume. The release of GAGs and biomarkers over time was quantified by plotting the concentration in the medium against time in culture and calculating the area under the curve (AUC) using GraphPad Prism 7 for each BEX explant. For biomarker AUCs the baseline was set at the LLMR for the individual biomarker. The distribution of the AUC values was tested using R (version 3.4.0) by plotting histograms and quantile-quantile (Q-Q) plots. Since the GAG and biomarker data did not follow a Gaussian distribution a non-parametric Kruskal-Wallis with Dunn’s multiple comparison test was used to test for differences of the AUCs of GAG, AGNx1, C2M and C3M between the treatments, where p < 0.05 was considered significant.
The proteomics data was exported from Proteome Discoverer for statistical data analysis and visualization using R (version 3.5.1). The individual explant (technical replicate) LFQ values were log2-transformed and averaged, giving mean log2 value per treatment per timepoint for each animal. The data was then filtered so that only proteins present in both animals in both the untreated and the IL-17-treated samples were retained. Then, AUC was calculated to obtain a single value per the treatment group ( untreated or IL-17A) within each animal, and the differences between untreated and IL-17 groups were compared for each protein using a reproducibility-optimized test statistic (ROTS) from ROTS package (47-50) (B = 1000), with adjusted p-value of <0.05 and FDR of <0.05 considered significant .